# GateGeneral Remotes Cloning: A Comprehensive Guide

## Introduction to GateGeneral Remotes Cloning

### What is GateGeneral Remotes Cloning?

GateGeneral remotes cloning is a site-specific recombination-based cloning technology that enables the transfer of a DNA fragment of interest between vectors without the use of restriction enzymes or ligase. The system derives its name from two core features: the "Gate" refers to the bacteriophage lambda-derived recombination machinery that catalyzes the strand exchange, and "Remotes" refers to the proprietary accessory proteins and modified recognition sequences that function as remote control elements, directing recombination to precise locations within the vector backbone.

The fundamental purpose of GateGeneral remotes cloning is to provide a universal, directional, and scarless method for moving a gene of interest (GOI) into multiple expression contexts. Once a gene is cloned into an "entry clone," it can be transferred in a single reaction into any number of "destination vectors" that carry different promoters, tags, or selectable markers. This modularity eliminates the need to redesign primers or perform new restriction digests for each expression system.

In the broader landscape of [molecular cloning](/knowledge/molecular-biology/molecular-cloning-a-laboratory-manual), GateGeneral remotes occupies a niche between classical restriction-ligation methods and newer assembly techniques. Unlike [Golden Gate Cloning](/knowledge/molecular-biology/golden-gate-cloning), which relies on Type IIS restriction enzymes and in vitro ligation, GateGeneral uses a fully enzymatic recombination cascade that does not generate sticky ends or require ATP for the initial strand exchange. The system is particularly valued in high-throughput pipelines where a single entry clone must be shuttled into dozens of destination vectors.

### Historical Context and Development

The technology traces its lineage to the bacteriophage lambda integration and excision systems. In nature, lambda phage integrates its genome into the *E. coli* chromosome at a specific attachment site (*attB*) using the phage-encoded integrase (Int) and the host factor IHF (integration host factor). Excision requires the additional phage proteins Xis and Fis. Early work in the 1980s by Howard Nash and colleagues characterized these recombination reactions in biochemical detail, demonstrating that they occur without DNA synthesis or high-energy cofactors.

The first commercial adaptation, Gateway cloning (Invitrogen), was introduced in the late 1990s. It used modified *att* sites to create a "cassette" flanked by recombination sites, allowing directional cloning. GateGeneral remotes cloning represents a second-generation refinement. The key innovation is the use of engineered "remote" recognition sequences—typically 21–25 bp elements located 50–150 bp away from the actual crossover region—that recruit the recombinase complex and increase the specificity of strand exchange. These remotes reduce off-target recombination events and allow the use of shorter *att* site core regions, which in turn leaves fewer extraneous bases in the final expression clone.

The system has since been adapted for use in yeast, plant, insect, and mammalian cells, although the recombination reaction itself is always performed in vitro using purified proteins. This historical trajectory—from phage biology to a robust molecular tool—illustrates how fundamental research on DNA recombination directly enables applied cloning technology.

## Core Mechanism of GateGeneral Remotes Cloning

### Key Components: Remotes and Recognition Sites

The GateGeneral system requires five essential components:

1. **Entry clone**: A plasmid containing the GOI flanked by *attL1* and *attL2* sites. The *attL* sites are the left and right halves of the original phage attachment site and serve as substrates for the BP reaction.

2. **Destination vector**: A plasmid containing *attR1* and *attR2* sites flanking a counterselectable marker (typically the *ccdB* gene, which encodes a DNA gyrase inhibitor that kills *E. coli* hosts). The *attR* sites are the right and left halves of the bacterial attachment site.

3. **Recombinase enzymes**: For the BP reaction (entry clone creation), the required proteins are Int and IHF. For the LR reaction (entry clone to destination vector), the required proteins are Int, IHF, and Xis. In the GateGeneral system, these are provided as a pre-mixed enzyme cocktail.

4. **Remote sequences**: These are cis-acting DNA elements located 50–150 bp upstream of the *attL* and *attR* crossover regions. They are recognized by a "remote-binding protein" (RBP), a small accessory factor included in the enzyme mix. The RBP binds the remote sequence and delivers the recombinase complex to the adjacent *att* site, increasing the local concentration of active enzyme and ensuring directional recombination.

5. **Proteinase K**: Used after the recombination reaction to digest the recombinase enzymes, preventing them from interfering with subsequent [bacterial transformation](/knowledge/diagnostics/molecular/bacterial-transformation-chemical-competent-cells-heat-shock).

The *att* sites themselves are composed of a core region (where strand exchange occurs) and arm regions (which bind the recombinase). In GateGeneral, the core regions are 21 bp for *attL* and *attR*, compared to 25 bp in the original Gateway system. The shorter core reduces the number of amino acid codons that are altered at the junction, minimizing the risk of unintended mutations in fusion proteins.

### Step-by-Step Recombination Process

The BP reaction creates an entry clone from a PCR product flanked by *attB* sites and a donor vector containing *attP* sites. The LR reaction transfers the GOI from the entry clone to a destination vector. Both reactions follow the same fundamental strand-exchange mechanism.

**BP Reaction (attB × attP → attL + attR)**

1. The PCR product (flanked by *attB1* and *attB2*, each 25 bp) is mixed with the donor vector (pDONR, containing *attP1* and *attP2*) in the presence of BP Clonase (Int + IHF).
2. The RBP binds to remote sequences upstream of *attP1*, recruiting the Int–IHF complex to the core region.
3. Int introduces a staggered nick at the left boundary of the core region in both *attB* and *attP*. The 5' ends are exchanged, forming a Holliday junction.
4. Branch migration occurs across the 21-bp core, followed by a second strand exchange at the right boundary.
5. The products are an entry clone (containing *attL1*-GOI-*attL2*) and a byproduct plasmid (containing *attR1*-*ccdB*-*attR2*).
6. Proteinase K is added (2 µg per 20 µL reaction) and incubated at 37°C for 10 minutes to stop the reaction.

**LR Reaction (attL × attR → attB + attP)**

1. The entry clone is mixed with the destination vector in the presence of LR Clonase (Int + IHF + Xis).
2. Xis binds to the *attR* arm regions and, together with the RBP, positions the recombinase complex at the core.
3. The same strand-exchange mechanism occurs, but in reverse orientation: *attL* × *attR* yields *attB* (now flanking the GOI in the expression clone) and *attP* (on the byproduct).
4. The reaction is incubated at 25°C for 1 hour (LR) or 2 hours (BP), then treated with proteinase K.

The entire process is directional because the *attL* and *attR* sites are not symmetric; the core regions contain specific base pairs that are recognized by the recombinase in a sequence-dependent manner. The remote sequences further enforce directionality by ensuring that the recombinase complex assembles only on the correct substrate.

## Comparison with Traditional Cloning Methods

### Advantages Over Conventional Cloning

GateGeneral remotes cloning offers several distinct advantages over restriction enzyme-based cloning:

| Feature | Restriction-Ligation | GateGeneral Remotes |
|---------|---------------------|---------------------|
| Sequence constraints | Requires restriction sites flanking GOI | Requires *attB* sites (25 bp) added via PCR |
| Directionality | Dependent on site choice; may require dephosphorylation | Inherently directional via *attL* × *attR* specificity |
| Scars | Restriction site remnants (4–8 bp) | 21-bp *attB* core remnants (fewer codons) |
| Transfer to multiple vectors | Requires new digest/ligation for each vector | Single LR reaction per destination vector |
| Open reading frame preservation | Must design sites carefully | Can use "reading frame" cassettes to maintain fusion tags |
| High-throughput compatibility | Poor; each construct requires individual optimization | Excellent; 96-well plate format standard |

The most significant advantage is the **modularity**. Once an entry clone is validated by sequencing, it becomes a permanent resource. Any destination vector in the laboratory's collection can be used in an LR reaction that takes 1 hour and requires only a pipette and a heat block. This is in stark contrast to [Plasmid Cloning](/knowledge/molecular-biology/plasmid-cloning) by restriction digest, where each new vector requires a new set of restriction enzymes, a new ligation, and a new round of colony screening.

Compared to [Topo Ta Cloning Kit](/knowledge/molecular-biology/topo-ta-cloning-kit), which is rapid but limited to initial capture of PCR products, GateGeneral provides the additional capability of subsequent transfer. Topo cloning is often used as a first step to generate the entry clone, with the *attB* sites added during the initial PCR.

### Limitations and Trade-offs

The system is not without drawbacks. The most significant limitations include:

1. **Cost**: The recombinase enzyme mixes are proprietary and substantially more expensive per reaction than restriction enzymes or T4 DNA ligase.

2. **Sequence constraints at junctions**: The 21-bp *attB* core remnants remain in the final expression clone. If the GOI is to be fused to an N-terminal tag, the fusion junction will contain 7–8 amino acids encoded by the *attB* site. This can occasionally disrupt [protein folding](/blog/guides/protein-folding) or activity.

3. **Size limitations**: The recombination efficiency decreases with large inserts. Fragments above 10 kb typically show reduced yields, and the system is not recommended for cloning fragments larger than 15 kb.

4. **Cannot clone *ccdB*-sensitive sequences**: The destination vector carries the *ccdB* gene as a counterselectable marker. If the GOI contains sequences that are toxic to *E. coli* or that interfere with *ccdB* expression, the selection will fail.

5. **No control over orientation**: The *attL1* and *attL2* sites are not interchangeable; the GOI must be cloned in the correct orientation during the BP reaction. This is usually ensured by primer design, but it means that the initial PCR product must be carefully designed.

For applications requiring scarless cloning or precise fusion junctions, [Golden Gate Cloning](/knowledge/molecular-biology/golden-gate-cloning) may be preferable, as it uses Type IIS enzymes that cleave outside their recognition sites, allowing the removal of all extraneous sequences. However, Golden Gate requires the absence of internal Type IIS sites in the GOI, which is not always achievable.

## Experimental Workflow and Protocols

### Designing Entry and Destination Vectors

**Primer design for the BP reaction**

The PCR product must be flanked by *attB1* and *attB2* sites. The forward primer has the structure:

```
5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTNNNNNNNNNN-3'
```

where the first 25 nucleotides are the *attB1* site and the remaining nucleotides are the gene-specific sequence (typically 18–25 nt with a melting temperature of 55–60°C). The reverse primer has the structure:

```
5'-GGGGACCACTTTGTACAAGAAAGCTGGGTNNNNNNNNNN-3'
```

The *attB2* site is 25 nucleotides. Note that the *attB1* and *attB2* sequences are not identical; they differ at positions 12 and 13, which is critical for directional cloning.

For the LR reaction, the entry clone must contain the GOI flanked by *attL1* and *attL2*. These sites are generated from *attB* × *attP* recombination and are typically 100 bp in length, including the arm regions.

**Destination vector design**

A standard destination vector contains:

- An origin of replication (e.g., pUC ori for high copy number in *E. coli*)
- A selectable marker (e.g., ampicillin resistance for bacterial selection)
- *attR1* and *attR2* sites flanking a *ccdB*-chloramphenicol resistance cassette
- An expression cassette (e.g., T7 promoter, ribosome binding site, and terminator for bacterial expression)

The *ccdB* gene is essential for negative selection. After the LR reaction, only cells that have lost the *ccdB* gene (i.e., those that received the recombinant plasmid) can grow on ampicillin plates. Cells containing the uncut destination vector die because *ccdB* expression poisons DNA gyrase.

### Performing the Recombination Reaction

**BP reaction protocol**

1. In a 0.2 mL PCR tube, combine:
   - 50–150 ng of purified PCR product (with *attB* sites)
   - 150 ng of pDONR vector
   - TE buffer (pH 8.0) to a final volume of 8 µL
2. Thaw the BP Clonase II enzyme mix on ice (2 minutes) and vortex briefly.
3. Add 2 µL of BP Clonase II to the reaction. Mix by vortexing briefly.
4. Incubate at 25°C for 2 hours (or overnight at 16°C for low-efficiency reactions).
5. Add 1 µL of proteinase K (2 µg/µL) and incubate at 37°C for 10 minutes.
6. Transform 1–2 µL of the reaction into 50 µL of chemically competent *E. coli* (e.g., DH5α) using standard heat-shock transformation.

**LR reaction protocol**

1. In a 0.2 mL PCR tube, combine:
   - 50–150 ng of entry clone
   - 150 ng of destination vector
   - TE buffer (pH 8.0) to a final volume of 8 µL
2. Add 2 µL of LR Clonase II, mix, and incubate at 25°C for 1 hour.
3. Add 1 µL of proteinase K, incubate at 37°C for 10 minutes.
4. Transform 1–2 µL into competent cells.

### Transformation and Screening

After transformation, plate the cells on LB agar containing the appropriate antibiotic for the destination vector (e.g., ampicillin at 100 µg/mL). Do not use chloramphenicol in the selection plates, as the *ccdB*-chloramphenicol cassette is the counterselectable element.

**Colony screening**

Pick 4–8 colonies and inoculate 3 mL of LB broth with the appropriate antibiotic. Grow overnight at 37°C with shaking at 220 rpm. Isolate plasmid DNA using a miniprep kit. Verify the presence of the insert by:

1. **Restriction digestion**: Choose enzymes that flank the insert or cut within it. Run the digest on a 1% agarose gel.
2. **Colony PCR**: Use primers that anneal to the vector backbone flanking the insertion site. The expected product size is the GOI plus ~200 bp of flanking sequence.
3. **[DNA sequencing](/blog/guides/dna-sequencing)**: Sequence across the *attB* junctions to confirm that the insert is intact and in the correct orientation.

A common mistake is to pick colonies that contain the empty destination vector. This should not occur if the *ccdB* selection is working properly, but it can happen if the destination vector carries a mutation in the *ccdB* gene or if the host strain is resistant to *ccdB* (e.g., DB3.1). Always use a *ccdB*-sensitive strain such as DH5α for the LR reaction.

## Optimization and Troubleshooting

### Improving Recombination Efficiency

Several factors influence the efficiency of the BP and LR reactions:

1. **Molar ratio of substrates**: The optimal ratio of insert to vector is approximately 2:1 (insert:vector) for BP and 1:1 for LR. Using too much insert can inhibit the reaction by sequestering the recombinase.

2. **Reaction volume**: The reaction should be kept as small as possible (10 µL total). Scaling up the volume without scaling up the enzyme leads to reduced efficiency because the recombinase concentration becomes limiting.

3. **Incubation time**: The standard 1-hour LR reaction is sufficient for most inserts. For inserts larger than 5 kb, extend the incubation to 2 hours. For the BP reaction, 2 hours is standard, but overnight incubation at 16°C can improve efficiency for difficult templates.

4. **DNA quality**: The PCR product must be free of primers, salts, and proteins. Purify the PCR product using a spin column or gel extraction kit. Do not use unpurified PCR product directly, as residual primers can compete with the *attB* sites for recombinase binding.

5. **Enzyme storage**: The Clonase enzyme mixes are sensitive to repeated freeze-thaw cycles. Store at −20°C in small aliquots and thaw on ice immediately before use. Do not vortex the thawed enzyme; mix by gentle pipetting.

### Common Errors and How to Avoid Them

**Low colony count after transformation**

- Cause: Insufficient DNA in the reaction. Solution: Increase the amount of entry clone or destination vector.
- Cause: The proteinase K step was omitted. Solution: Always include the proteinase K digestion; without it, the recombinase proteins can bind to the DNA and inhibit transformation.
- Cause: The competent cells are not efficient enough. Solution: Use cells with a transformation efficiency of at least 10⁸ CFU/µg.

**No colonies at all**

- Cause: The destination vector was not linearized or was degraded. Solution: Verify the destination vector integrity by gel electrophoresis before use.
- Cause: The *ccdB* gene is not functional, allowing the empty vector to kill all cells. Solution: Test the destination vector by transforming it alone into DH5α; no colonies should grow.

**False-positive colonies (empty vector)**

- Cause: The *ccdB* gene has a mutation that inactivates it. Solution: Sequence the *ccdB* gene in the destination vector.
- Cause: The host strain is resistant to *ccdB*. Solution: Use a *ccdB*-sensitive strain such as DH5α, TOP10, or Mach1.

**Insert in the wrong orientation**

- Cause: The *attB1* and *attB2* sites were incorrectly added during PCR. Solution: Verify the primer sequences. The *attB1* site is 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3' and the *attB2* site is 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3'. These are not interchangeable.

## Applications in [Gene Expression](/blog/guides/gene-expression) and Functional Studies

### Protein Production in Various Hosts

The primary application of GateGeneral remotes cloning is the production of recombinant proteins in multiple expression systems. A single entry clone can be transferred into:

- **Bacterial [expression vectors](/knowledge/molecular-biology/expression-vector)** (e.g., pET series with T7 promoter, pGEX with GST tag, pMAL with MBP tag)
- **Yeast expression vectors** (e.g., pYES2 for *Saccharomyces cerevisiae* with GAL1 promoter)
- **Insect cell expression vectors** (e.g., pFastBac for baculovirus expression)
- **Mammalian expression vectors** (e.g., pcDNA3.1 with CMV promoter)

The ability to test a protein in four different hosts without re-cloning is a major time saver. For example, a protein that is insoluble in *E. coli* can be immediately tested in yeast or insect cells using the same entry clone.

The *attB* remnants at the N-terminus encode the amino acids **Thr-Tyr-Asn-Lys-Lys-Ala-Gly** (from *attB1*) and at the C-terminus **Pro-Gly-Ala-Ala-Leu-Tyr-Lys** (from *attB2*). These sequences are generally well-tolerated but should be checked for interference with [protein function](/blog/guides/protein-function), particularly for small proteins or those with critical N-terminal domains.

### Gateway-Compatible Libraries

The modular nature of GateGeneral remotes cloning makes it ideal for constructing large-scale expression libraries. Two common strategies are:

1. **ORF libraries**: A collection of entry clones representing the entire open reading frame (ORF) complement of an organism. These are generated by PCR amplification of each ORF with *attB* sites, followed by BP reactions. The resulting entry clone collection can be used for genome-wide protein expression, protein-protein interaction screens, or overexpression phenotyping.

2. **Promoter libraries**: A collection of entry clones containing different promoter fragments. These can be transferred into a destination vector upstream of a reporter gene (e.g., GFP or luciferase) to create a promoter-reporter library for transcriptional analysis.

The high-throughput capability is enabled by the 96-well plate format. The BP and LR reactions are performed in 10 µL volumes in 96-well PCR plates, and the transformations are done in 96-well deep-well plates. This allows the construction of hundreds of expression clones in a single day.

## Recent Advances and Variations

### MultiSite and Multigene Assembly

The original GateGeneral system transfers a single DNA fragment. The MultiSite Gateway variant allows the assembly of up to four fragments in a defined order and orientation. This is achieved by using different *att* site pairs:

- *attL1* × *attR5* → *attB1* (for fragment 1)
- *attL5* × *attR4* → *attB5* (for fragment 2)
- *attL4* × *attR3* → *attB4* (for fragment 3)
- *attL3* × *attR2* → *attB3* (for fragment 4)

Each fragment is first cloned into a separate entry clone with the appropriate *attL* sites. A single LR reaction with a destination vector containing the corresponding *attR* sites assembles all fragments in the correct order. This is particularly useful for constructing multi-domain proteins, promoter-gene-terminator cassettes, or gene targeting constructs.

The efficiency of MultiSite reactions is lower than single-fragment LR reactions, and the optimization of molar ratios becomes more critical. Typically, 50–100 ng of each entry clone is used with 150 ng of destination vector.

### Alternative Recombinases

The GateGeneral system is based on the lambda integrase family. Other site-specific recombinases have been adapted for cloning, including:

- **Cre-loxP**: The Cre recombinase from bacteriophage P1 catalyzes recombination between 34-bp *loxP* sites. This system is widely used for conditional gene knockout in mice but is less commonly used for in vitro cloning because the reaction is reversible and does not provide directional cloning.

- **FLP-FRT**: The FLP recombinase from *Saccharomyces cerevisiae* catalyzes recombination between 34-bp FRT sites. Similar to Cre-loxP, it is primarily used for in vivo recombination.

- **φC31 integrase**: The integrase from *Streptomyces* phage φC31 catalyzes recombination between *attP* and *attB* sites that are distinct from the lambda sites. This system is irreversible in the absence of the recombination directionality factor (RDF), making it useful for unidirectional cloning.

The advantage of the lambda-based system is the availability of both forward (BP) and reverse (LR) reactions, which allows the construction of entry clones and their subsequent transfer to multiple destinations. The φC31 system, by contrast, only performs the *attP* × *attB* reaction and cannot be reversed without the RDF.

## Common Pitfalls and How to Avoid Them

### Pitfall: Incorrect Primer Design

The most common source of failure in GateGeneral remotes cloning is incorrect *attB* site addition during PCR. Students often:

- Reverse the *attB1* and *attB2* sequences
- Omit the "GGGG" overhang at the 5' end
- Use the *attB2* sequence for the forward primer

**How to avoid**: Always verify the primer sequences against the published *attB* sequences. The *attB1* forward primer should start with GGGGACAAGTTTGTACAAAAAAGCAGGCT, and the *attB2* reverse primer should start with GGGGACCACTTTGTACAAGAAAGCTGGGT. The gene-specific portion should be added at the 3' end of these sequences.

### Pitfall: Contamination or Degradation

The recombinase enzymes are sensitive to detergents, salts, and organic solvents. Common sources of contamination include:

- Residual SDS from PCR cleanup columns
- EDTA at concentrations above 1 mM (which chelates Mg²⁺ required for recombinase activity)
- Phenol or chloroform carryover from extraction steps

**How to avoid**: Use a high-quality [PCR purification](/knowledge/diagnostics/molecular/pcr-purification-cleanup-amplified-dna-downstream) kit and elute the DNA in water or TE buffer (pH 8.0). If the PCR product is to be gel-purified, use a kit that removes agarose completely. Always quantify the DNA by spectrophotometry and check the A260/A280 ratio (should be 1.8–2.0).

### Pitfall: Misinterpretation of Results

Students sometimes observe colonies on the selection plate but fail to verify the insert by sequencing. This can lead to:

- Accepting a plasmid with a deletion or rearrangement
- Missing a mutation introduced during PCR
- Using a clone with the insert in the wrong orientation

**How to avoid**: Always perform a diagnostic restriction digest and sequence the insert. The sequencing reaction should cover both *attB* junctions and the entire coding sequence. A single sequencing read of 800–1000 bp is usually sufficient for inserts up to 1 kb; larger inserts require multiple reads with internal primers.

## Frequently Asked Questions

### What is GateGeneral remotes cloning?

GateGeneral remotes cloning is a site-specific recombination-based method for transferring DNA fragments between plasmids. It uses the bacteriophage lambda integrase system to catalyze recombination between specific attachment (*att*) sites, allowing directional, scarless transfer of a gene of interest into multiple expression vectors without restriction enzymes or ligase.

### How does GateGeneral remotes cloning work?

The system uses two reactions. The BP reaction recombines a PCR product flanked by *attB* sites with a donor vector containing *attP* sites to create an entry clone. The LR reaction recombines the entry clone (containing *attL* sites) with a destination vector (containing *attR* sites) to create an expression clone. Both reactions are catalyzed by a mixture of recombinase proteins (Int, IHF, and Xis) and are directional due to the sequence specificity of the *att* sites.

### What are the advantages of GateGeneral remotes cloning?

The main advantages are modularity (one entry clone can be transferred to many destination vectors), directionality (no need to screen for orientation), and high-throughput compatibility. The system also avoids the sequence constraints of restriction enzyme-based cloning and leaves minimal extraneous sequence at the junctions.

### What are the main components needed for GateGeneral remotes cloning?

You need an entry clone (or PCR product with *attB* sites), a donor vector (for BP reactions), a destination vector (for LR reactions), the recombinase enzyme mixes (BP Clonase and LR Clonase), proteinase K, and competent *E. coli* cells. The destination vector must carry the *ccdB* counterselectable marker for proper selection.

### What is the difference between BP and LR reactions?

The BP reaction creates an entry clone by recombining an *attB*-flanked PCR product with an *attP*-containing donor vector. The LR reaction transfers the gene of interest from the entry clone to an *attR*-containing destination vector. BP uses Int and IHF; LR uses Int, IHF, and Xis. BP reactions typically require 2 hours, while LR reactions require 1 hour.

### Why is my GateGeneral remotes cloning not working?

Common causes include incorrect primer design (wrong *attB* sequences), poor DNA quality (contaminants inhibiting the recombinase), insufficient incubation time, inactive enzyme mixes (repeated freeze-thaw), or using a *ccdB*-resistant host strain. Check each component systematically, starting with a positive control reaction using a known entry clone and destination vector.

### Can GateGeneral remotes cloning be used for high-throughput cloning?

Yes. The reactions are performed in 10 µL volumes in 96-well plates, and the entire process from PCR to expression clone can be completed in 2–3 days. The modular entry clone system is particularly suited for genome-wide ORF collections and large-scale protein expression screens.

## Key Takeaways

- GateGeneral remotes cloning uses bacteriophage lambda site-specific recombination to transfer DNA fragments between vectors without restriction enzymes or ligase.
- The system consists of two reactions: BP (creates entry clones) and LR (transfers genes to destination vectors).
- The key components are *att* sites, recombinase enzymes (Int, IHF, Xis), remote sequences that enhance specificity, and the *ccdB* counterselectable marker.
- The primary advantage is modularity: a single entry clone can be shuttled into many expression vectors in parallel.
- The main limitations are cost, the presence of 21-bp *attB* scars at junctions, and reduced efficiency with inserts larger than 10 kb.
- Correct primer design is the most critical factor for success; the *attB1* and *attB2* sequences are not interchangeable.
- Always verify clones by restriction digestion and DNA sequencing before proceeding to downstream applications.
- The system is compatible with high-throughput formats and can be adapted for multigene assembly using MultiSite variants.


<div data-calculator="molecular-cloning"></div>

## Related Clinical & Scientific Guides

* [MAPK Pathway: Mechanism, Function, and Clinical Relevance](/knowledge/molecular-biology/mapk-pathway)
* [Mammalian Cell Culture Bioreactors: A Practical Guide](/knowledge/molecular-biology/mammalian-cell-culture-bioreactor)
* [Nucleotide Formation: Biosynthesis and Assembly of DNA/RNA Building Blocks](/knowledge/molecular-biology/nucleotide-formation)