# A User's Guide to [Cell-Free Protein Synthesis](/knowledge/molecular-biology/cell-free-protein-synthesis-cfps)

## Introduction to Cell-Free [Protein Synthesis](/blog/guides/protein-synthesis-a-step-by-step-guide-to-transcription-and-translation)

Cell-free [protein synthesis](/blog/guides/protein-synthesis-a-step-by-step-guide-to-transcription-and-translation) (CFPS) is a method for producing proteins in vitro using the extracted transcriptional and translational machinery of a cell, rather than relying on living cells as production hosts. In a CFPS reaction, a crude or purified lysate containing ribosomes, tRNAs, aminoacyl-tRNA synthetases, initiation and elongation factors, and polymerases is combined with a DNA template, amino acids, nucleotides, and an energy source to drive protein production directly in a test tube. The reaction typically proceeds for 2 to 24 hours at temperatures ranging from 25°C to 37°C, depending on the system, and yields protein in the range of 0.1 to several milligrams per milliliter of reaction volume.

The origins of CFPS date to the 1960s, when Nirenberg and Matthaei used extracts of *E. coli* to decipher the genetic code by translating synthetic RNA polymers. For decades, the technology remained a research tool for studying translation mechanisms. The field was revitalized in the early 2000s with the development of more robust energy regeneration systems and optimized extract preparation protocols, transforming CFPS from a low-yield analytical technique into a preparative method capable of producing gram-scale quantities of protein in cell-free reactions.

### What is CFPS?

CFPS is an open, in vitro system in which protein synthesis is uncoupled from cell viability. Because the reaction is not constrained by a cell membrane, the user has direct access to the reaction environment. This allows for precise control over reaction conditions, direct sampling without cell lysis, and the ability to add or remove components at any time during the reaction. The system operates by combining a cell extract—the soluble contents of lysed cells containing the translation machinery—with a template encoding the gene of interest, and a reaction buffer that supplies energy, amino acids, and cofactors.

The extract is the heart of the system. It contains ribosomes at concentrations of 1 to 3 µM, tRNAs, translation factors, and metabolic enzymes that can regenerate ATP from energy substrates. The extract also contains endogenous nucleases and proteases that must be inactivated or removed during preparation to prevent template degradation and product proteolysis. Most modern CFPS systems use extracts from *E. coli* strains engineered to lack the major proteases (e.g., Lon and OmpT) and to stabilize the T7 RNA polymerase used for transcription.

### Advantages over in vivo systems

CFPS offers several distinct advantages over protein production in living cells. First, because there is no cell wall or membrane, the system is not limited by substrate import or product export. Proteins that are toxic to host cells—such as membrane proteins, proteases, or antimicrobial peptides—can be produced in CFPS without killing the production host. Second, the open nature of the reaction allows direct manipulation of the chemical environment. Disulfide bond formation can be promoted by adding oxidizing agents and protein disulfide isomerase; non-natural amino acids can be incorporated by adding orthogonal aminoacyl-tRNA synthetases and suppressor tRNAs; and isotopic labeling for NMR or neutron scattering is straightforward because the amino acid pool is defined by the user.

Third, CFPS is rapid. A typical reaction from DNA template to purified protein can be completed in a single day, compared to the days or weeks required for cloning, transformation, culture, induction, and lysis in vivo. Fourth, the system is highly parallelizable. Reactions can be run in 96- or 384-well plates, enabling high-throughput screening of many variants or conditions simultaneously. Finally, CFPS reactions can be lyophilized and stored, allowing for on-demand protein production from a stable, shelf-stable kit—a feature exploited in point-of-care diagnostics and field-deployable biosensors.

## Core Components of a CFPS Reaction

A standard CFPS reaction consists of five essential components: cell extract, reaction buffer, an energy regeneration system, amino acids, and template DNA. The concentrations and quality of each component directly determine the yield and fidelity of the synthesized protein.

### Cell extract preparation

The cell extract is prepared by lysing cells and removing cell debris, genomic DNA, and cell wall components. For *E. coli*, the standard protocol involves growing cells to mid-log phase (OD₆₀₀ of 0.4–0.6), harvesting by centrifugation, and washing the cell pellet to remove growth media. The cells are then lysed by sonication, French press, or high-pressure homogenization in a lysis buffer containing 10 mM Tris-acetate (pH 8.2), 14 mM magnesium acetate, 60 mM potassium glutamate, and 1 mM dithiothreitol (DTT). After lysis, the crude lysate is centrifuged at 12,000 × g for 10 minutes at 4°C to remove unbroken cells and debris, followed by a high-speed centrifugation at 30,000 × g for 30 minutes to pellet the membrane fraction. The supernatant is collected, and a "run-off" incubation is performed at 37°C for 30 to 60 minutes to allow endogenous mRNA to be translated and degraded, reducing background protein synthesis. Finally, the extract is dialyzed against the lysis buffer and stored at −80°C in small aliquots.

The quality of the extract is the single most important determinant of CFPS yield. Extracts with high ribosome content and low nuclease activity produce the best results. The protein concentration of a typical *E. coli* extract is 30 to 40 mg/mL, and the optimal extract concentration in a CFPS reaction is usually 20% to 40% of the total reaction volume. For eukaryotic systems, the extract preparation is more involved. Wheat germ extract, for example, is prepared from toasted wheat germ, which is ground and extracted in a buffer containing 80 mM potassium acetate, 5 mM magnesium acetate, and 20 mM HEPES-KOH (pH 7.6). The extract is then subjected to gel filtration to remove small molecules and endogenous amino acids.

### Energy regeneration systems

Protein synthesis is energetically expensive. Each peptide bond requires the hydrolysis of four high-energy phosphate bonds: two from ATP for aminoacyl-tRNA charging and two from GTP for elongation factor Tu (EF-Tu) binding and translocation. A CFPS reaction therefore requires a robust energy regeneration system to maintain ATP and GTP concentrations in the millimolar range.

The most common energy regeneration systems are based on phosphoenolpyruvate (PEP), creatine phosphate, or glucose. In the PEP system, pyruvate kinase converts PEP and ADP to pyruvate and ATP. The creatine phosphate system uses creatine kinase to transfer phosphate from creatine phosphate to ADP. The glucose system is unique to *E. coli* extracts because it relies on endogenous glycolytic enzymes to metabolize glucose to pyruvate, generating ATP through substrate-level phosphorylation. The glucose system is advantageous for cost and for maintaining redox balance, but it produces organic acids that can acidify the reaction. For this reason, glucose-based systems require the addition of a pH buffer such as 100 mM HEPES-KOH (pH 7.2) or the use of a pH-stat to maintain optimal pH.

A typical CFPS reaction contains 10 to 30 mM of the energy substrate (PEP, creatine phosphate, or glucose), 1 to 2 mM ATP, 1 to 2 mM GTP, and 0.5 to 1 mM of each of CTP and UTP for transcription. In addition, 10 to 20 mM magnesium acetate is required, as magnesium is a cofactor for ATP and GTP and is essential for ribosome function. The optimal magnesium concentration must be empirically determined for each extract and template combination, as excess magnesium inhibits translation while insufficient magnesium limits it.

### Template DNA formats

The template DNA can be provided as a plasmid, a linear PCR product, or a linear expression cassette. Plasmid templates are the most common because they are stable and can be prepared at high purity. However, plasmids require cloning, which adds time to the workflow. Linear PCR products are faster to generate but are susceptible to degradation by endogenous exonucleases in the extract. This problem can be mitigated by using *E. coli* strains deficient in RecBCD exonuclease, or by adding a chi site sequence to the ends of the linear DNA to protect it from degradation. Alternatively, the extract can be treated with a nuclease inhibitor such as gamS protein, which binds to and inhibits RecBCD.

The template concentration is typically 5 to 50 nM for plasmid DNA and 10 to 100 nM for linear DNA. The gene of interest should be placed under the control of a strong promoter. For *E. coli* extracts, the T7 promoter is most commonly used because T7 RNA polymerase is highly processive and produces large amounts of mRNA. For eukaryotic extracts, the SP6 or T3 promoters are used with their cognate polymerases, or the endogenous RNA polymerase II system can be used with a promoter recognized by the extract's own transcription machinery.

## Mechanism of [Transcription and Translation](/knowledge/molecular-biology/transcription-translation) in CFPS

CFPS relies on the same fundamental mechanisms of transcription and translation that operate in living cells, but with important differences in how these processes are coupled and regulated.

### Coupled transcription-translation

In prokaryotic CFPS systems, transcription and translation are coupled: ribosomes bind to the mRNA as it is being synthesized by RNA polymerase. This coupling is efficient because there is no nuclear membrane separating the two processes, and it allows translation to begin before transcription is complete. In the extract, the endogenous *E. coli* RNA polymerase can transcribe genes from native promoters, but the most efficient transcription is achieved using bacteriophage T7 RNA polymerase, which is added to the reaction or expressed from the extract strain.

T7 RNA polymerase is a single-subunit enzyme that is highly processive and does not require auxiliary [transcription factors](/knowledge/molecular-biology/transcription-factor). It recognizes the T7 promoter (TAATACGACTCACTATAGGGAGA) and synthesizes mRNA at a rate of approximately 200 nucleotides per second—about five times faster than the *E. coli* RNA polymerase. The mRNA produced by T7 polymerase lacks the 5' cap structure and the 3' poly-A tail found on eukaryotic mRNAs, but this is not a problem for prokaryotic translation, which does not require these features. The mRNA does, however, require a Shine-Dalgarno sequence (AGGAGG) upstream of the start codon to direct ribosome binding.

### Role of T7 RNA polymerase

T7 RNA polymerase is typically added to the CFPS reaction at a concentration of 10 to 100 µg/mL, or it is produced in situ from a plasmid encoding the polymerase gene under the control of a constitutive promoter. The latter approach is common in "self-consistent" CFPS systems where the extract is prepared from an *E. coli* strain that carries the T7 RNA polymerase gene on its chromosome under the control of the lacUV5 promoter. In this case, the polymerase is present in the extract at a concentration of approximately 1 to 5 µM.

One important consideration is that T7 RNA polymerase is sensitive to inhibition by the product of its own transcription. High concentrations of mRNA can sequester the polymerase and reduce transcription efficiency. This can be mitigated by using a moderate template concentration (10–30 nM) and by optimizing the reaction time. Additionally, T7 RNA polymerase requires magnesium as a cofactor, and the optimal magnesium concentration for transcription (10–15 mM) is slightly higher than that for translation (8–12 mM). The final magnesium concentration in the reaction is therefore a compromise between these two optima.

### Ribosome recycling and elongation

The ribosome is the central engine of translation. In *E. coli*, the ribosome is a 70S particle composed of a 50S large subunit and a 30S small subunit. Translation initiation requires the 30S subunit, mRNA, initiator tRNA (fMet-tRNA^fMet), and three initiation factors (IF1, IF2, IF3). The 30S subunit binds to the Shine-Dalgarno sequence on the mRNA, and the initiator tRNA base-pairs with the AUG start codon in the P site. The 50S subunit then joins to form the 70S initiation complex.

Elongation proceeds through the delivery of aminoacyl-tRNAs to the A site by EF-Tu, peptide bond formation in the peptidyl transferase center of the 50S subunit, and translocation by EF-G. The elongation rate in CFPS is approximately 5 to 10 amino acids per second at 37°C, which is comparable to in vivo rates. However, the rate can be reduced by limiting concentrations of aminoacyl-tRNAs or by the presence of rare codons that are poorly represented in the tRNA pool.

Ribosome recycling is a critical factor in CFPS yield. After translation termination, the ribosome must be recycled to initiate translation of a new mRNA. In *E. coli*, this requires ribosome recycling factor (RRF), EF-G, and IF3. In a CFPS reaction, the ribosome concentration is fixed by the extract, and each ribosome must translate multiple mRNAs to achieve high yields. The typical ribosome concentration in an *E. coli* extract is 2 to 4 µM, and a well-optimized CFPS reaction can produce 1 to 2 mg/mL of protein, which corresponds to approximately 50 to 100 protein molecules per ribosome.

## Common CFPS Systems and Their Characteristics

Several CFPS systems are commercially available and widely used in research. Each system has distinct characteristics in terms of yield, post-translational modifications, ease of use, and cost.

| System | Source | Typical Yield (mg/mL) | Post-translational Modifications | Advantages | Limitations |
|--------|-------|----------------------|----------------------------------|------------|-------------|
| *E. coli* | Bacterial | 0.5–2.5 | None (no glycosylation, no disulfide bonds unless oxidizing conditions) | High yield, low cost, fast, scalable | No eukaryotic modifications, endotoxin contamination |
| Wheat germ | Plant | 0.1–0.5 | Limited (no glycosylation) | Eukaryotic chaperones, good for complex proteins, low background | Lower yield, higher cost, requires specialized extract |
| Rabbit reticulocyte | Mammalian | 0.01–0.1 | Some (acetylation, phosphorylation) | Eukaryotic machinery, good for studying translation regulation | Low yield, high cost, batch variability |
| CHO | Mammalian | 0.05–0.3 | Glycosylation (if supplemented with microsomes) | Mammalian folding and modifications | Lower yield, complex extract preparation |
| Insect (Sf21) | Insect | 0.05–0.2 | Phosphorylation, some glycosylation | Eukaryotic chaperones, good for membrane proteins | Lower yield, specialized equipment |

### E. coli-based systems

The *E. coli* CFPS system is the most widely used and best characterized. It offers the highest yields, the lowest cost, and the greatest scalability. The system is based on extracts from *E. coli* strains such as BL21(DE3), which carries the T7 RNA polymerase gene, or from strains specifically engineered for CFPS, such as the A19 strain (deficient in RNase I) or the BL21 Star strain (deficient in RNase E). The *E. coli* system is ideal for producing proteins that do not require post-translational modifications, such as enzymes, structural proteins, and antigens.

One limitation of the *E. coli* system is its inability to form disulfide bonds in the reducing environment of the cytoplasm. This can be overcome by using extracts from mutant strains with a more oxidizing cytoplasm, such as the Origami or SHuffle strains, or by adding oxidizing agents (e.g., oxidized glutathione) and protein disulfide isomerase to the reaction. For proteins that require glycosylation or other eukaryotic modifications, the *E. coli* system is not suitable.

### Eukaryotic systems

Wheat germ extract is a popular eukaryotic CFPS system because it is inexpensive, easy to prepare, and contains high concentrations of eukaryotic chaperones that assist in protein folding. The wheat germ system is particularly good for producing proteins that are difficult to express in *E. coli*, such as multi-domain proteins and proteins with complex folding requirements. However, the yield is typically lower than that of the *E. coli* system, and the extract must be prepared from fresh wheat germ, which can be variable in quality.

Rabbit reticulocyte lysate is another eukaryotic system, derived from the blood of anemic rabbits. It is widely used for studying translation regulation and for producing small amounts of protein for functional assays. The system has a low background of endogenous protein synthesis and is highly responsive to exogenous mRNA. However, the yield is low (typically less than 0.1 mg/mL), and the cost is high, making it unsuitable for preparative applications.

### CHO and insect cell extracts

Chinese hamster ovary (CHO) cell extracts and insect cell extracts (from Sf21 or Sf9 cells) are newer additions to the CFPS toolkit. These systems offer the advantage of mammalian or insect chaperones and the potential for post-translational modifications when supplemented with microsomal membranes. CHO extracts can perform N-linked glycosylation when microsomes are added, making them useful for producing glycoproteins for structural studies. Insect cell extracts are particularly good for producing membrane proteins, as they contain the chaperones and lipid environment needed for proper membrane protein folding. However, these systems are more expensive and technically demanding than the *E. coli* system, and their yields are generally lower.

## Optimizing CFPS Yield and Productivity

Achieving high yields in CFPS requires careful optimization of reaction conditions. The key parameters are extract concentration, temperature, pH, magnesium concentration, and the addition of folding additives.

### Reaction conditions

The optimal temperature for *E. coli* CFPS is 30°C to 37°C. At 37°C, the reaction proceeds rapidly but may be limited by mRNA degradation and energy depletion. At 30°C, the reaction is slower but may produce higher yields due to reduced mRNA degradation and more efficient protein folding. For eukaryotic systems, the optimal temperature is typically 25°C to 30°C.

The pH of the reaction is maintained by the buffer, typically 50 to 100 mM HEPES-KOH (pH 7.2 to 7.5) or Tris-acetate (pH 8.0). The pH can drop during the reaction due to the release of protons from ATP hydrolysis and amino acid polymerization. This is particularly problematic in glucose-based energy systems, which produce organic acids. The addition of a high-concentration buffer (100 mM HEPES) or the use of a pH-stat can mitigate this issue.

The magnesium concentration is the most critical variable. The optimal concentration is typically 8 to 16 mM for *E. coli* CFPS, but the exact optimum depends on the concentrations of ATP, GTP, and DNA in the reaction, all of which chelate magnesium. A magnesium titration (e.g., 8, 10, 12, 14, 16 mM) should be performed for each new extract and template combination. The potassium concentration is also important, with 100 to 200 mM potassium glutamate being optimal for *E. coli* CFPS. Potassium glutamate is preferred over potassium chloride because it is the natural intracellular salt and is less inhibitory to translation.

### Additives for folding

Many proteins require assistance to fold correctly in CFPS. The addition of molecular chaperones, such as GroEL/GroES, DnaK/DnaJ/GrpE, or trigger factor, can improve the yield of soluble protein. These chaperones can be added to the reaction as purified proteins or co-expressed from a plasmid. For proteins with disulfide bonds, the addition of 1 to 4 mM oxidized glutathione (GSSG) and 0.1 to 1 mM reduced glutathione (GSH) creates an oxidizing environment that promotes disulfide bond formation. Protein disulfide isomerase (PDI) can also be added at 10 to 100 µg/mL to catalyze the rearrangement of incorrect disulfide bonds.

For membrane proteins, the addition of detergents or lipids is essential. The detergent Brij-35 (0.05% to 0.1%) or digitonin (0.1% to 0.4%) can be used to solubilize the nascent membrane protein as it emerges from the ribosome. Alternatively, pre-formed liposomes or nanodiscs can be added to provide a lipid bilayer environment for membrane protein insertion.

### Scale-up strategies

CFPS reactions can be scaled from microliter to liter volumes. For small-scale reactions (10–100 µL), reactions are typically run in microcentrifuge tubes or 96-well plates. For larger scales, dialysis-based systems are used. In a dialysis CFPS reaction, the reaction mixture is placed inside a dialysis membrane with a molecular weight cutoff of 10 to 14 kDa, and the membrane is submerged in a larger volume of buffer containing the energy substrates, amino acids, and nucleotides. This allows small molecules to diffuse into the reaction while retaining the high-molecular-weight protein product and the translation machinery. Dialysis CFPS can extend the reaction time to 12 to 24 hours and increase yields by 2- to 5-fold compared to batch reactions.

For industrial-scale production, continuous exchange cell-free (CECF) systems use a hollow-fiber bioreactor to continuously supply substrates and remove waste products. These systems can produce gram quantities of protein from a single reaction. However, they require specialized equipment and are not commonly used in academic laboratories.

## Applications of Cell-Free Protein Synthesis

CFPS has found widespread applications in both basic research and biotechnology. The open nature of the system makes it particularly well-suited for applications that are difficult or impossible with in vivo expression.

### Screening and evolution

CFPS is an ideal platform for high-throughput screening of protein variants. Because reactions can be run in 96- or 384-well plates, thousands of variants can be expressed and assayed in a single day. This has been used for [directed evolution](/knowledge/molecular-biology/directed-evolution) of enzymes, where libraries of variants are generated by error-prone PCR or DNA shuffling, expressed in CFPS, and screened for improved activity or stability. The [Cell-free Protein Synthesis System](/knowledge/molecular-biology/cell-free-protein-synthesis-system) is also compatible with ribosome display and mRNA display, techniques that link the phenotype (protein function) to the genotype (mRNA) for in vitro evolution.

CFPS is also used for [Protein Engineering](/knowledge/molecular-biology/protein-engineering), where the ability to add non-natural components to the reaction enables the incorporation of non-standard amino acids at specific positions. This has been used to create proteins with enhanced stability, novel catalytic activities, or fluorescent properties.

### Non-standard amino acids

The incorporation of non-standard amino acids (nsAAs) is one of the most powerful applications of CFPS. In vivo, the incorporation of nsAAs requires the introduction of an orthogonal tRNA/synthetase pair and the evolution of the synthetase to charge the nsAA. In CFPS, the orthogonal pair can be added directly to the reaction, and the nsAA is simply included in the amino acid mixture. This bypasses the need for cell viability and allows for the rapid testing of multiple nsAAs in parallel.

The most common approach uses the M. jannaschii tyrosyl-tRNA synthetase/tRNA pair, which has been evolved to charge a variety of nsAAs, including azido-tyrosine, benzoyl-phenylalanine, and p-acetyl-phenylalanine. The nsAA is incorporated in response to an amber stop codon (UAG) placed at the desired position in the gene. Yields of nsAA-containing proteins in CFPS are typically 0.1 to 0.5 mg/mL, which is sufficient for most structural and functional studies.

### Membrane proteins and toxic proteins

Membrane proteins are notoriously difficult to produce in vivo because they are toxic to host cells and tend to aggregate when overexpressed. CFPS offers a solution because the reaction can be supplemented with detergents or lipids that solubilize the nascent membrane protein. This has enabled the production of G protein-coupled receptors (GPCRs), ion channels, and transporters for structural studies. The [Cell-free Protein Production](/knowledge/molecular-biology/cell-free-protein-production) approach has been used to produce the β2-adrenergic receptor, the voltage-gated potassium channel KvAP, and the bacterial transporter LeuT in functional form.

Toxic proteins, such as antimicrobial peptides, proteases, and toxins, can also be produced in CFPS because there is no living cell to kill. This has been used to produce the antimicrobial peptide cecropin P1, the restriction enzyme EcoRI, and the diphtheria toxin A chain. The ability to produce toxic proteins in CFPS has also enabled the development of cell-free biosensors, where a protein that is toxic to cells is used as a reporter for the presence of a specific analyte.

## Analytical Methods for CFPS Products

After a CFPS reaction is complete, the protein product must be quantified and characterized. Several methods are available, each with its own advantages and limitations.

### Quantification methods

The simplest method for quantifying CFPS yield is to measure the incorporation of a radiolabeled amino acid, such as ¹⁴C-leucine or ³⁵S-methionine, into trichloroacetic acid (TCA)-precipitable material. This method is sensitive and quantitative but requires radioactivity and does not distinguish between the protein of interest and background proteins.

A more convenient method is to use a reporter protein, such as green fluorescent protein (GFP), which can be quantified by fluorescence. GFP is commonly used as a reporter in CFPS because its fluorescence is proportional to the amount of folded protein. However, GFP fluorescence only measures the soluble, folded fraction of the protein, not the total protein synthesized.

For quantitative analysis of a specific protein, an enzyme-linked immunosorbent assay (ELISA) or a Western blot can be used. These methods require an antibody against the protein of interest and provide information about both the quantity and the molecular weight of the product. For proteins with enzymatic activity, an activity assay is often the most relevant measure of yield.

### Quality assessment

The quality of the CFPS product is assessed by SDS-PAGE followed by Coomassie blue staining or Western blotting. SDS-PAGE reveals the molecular weight of the product and the presence of degradation products or truncation products. The purity of the product can be estimated from the intensity of the Coomassie-stained band relative to the total protein in the lane.

For proteins that require post-translational modifications, mass spectrometry is the method of choice for characterizing the modifications. [Intact protein mass spectrometry](/knowledge/molecular-biology/intact-protein-mass-spectrometry) can reveal the presence of phosphorylation, acetylation, or glycosylation, while peptide mass fingerprinting can localize the modification to specific residues. Mass spectrometry is also used to verify the incorporation of non-standard amino acids and to check for the presence of oxidation or other chemical modifications.

For structural studies, the protein can be characterized by circular dichroism (CD) spectroscopy to assess secondary structure, or by size-exclusion chromatography (SEC) to assess oligomeric state and aggregation. Dynamic light scattering (DLS) is a quick method for assessing the monodispersity of the sample.

## Common Pitfalls and Troubleshooting in CFPS

CFPS is a robust technology, but users will inevitably encounter problems. The most common issues are low yield, protein insolubility, and batch-to-batch variability.

### Low yield causes

Low yield is the most frequent complaint. The first thing to check is the quality of the DNA template. Plasmid DNA should be pure (A₂₆₀/A₂₈₀ ratio of 1.8–2.0) and free of RNA contamination. Linear DNA should be checked by agarose gel electrophoresis for degradation. The template concentration should be titrated; too little template limits transcription, while too much template can sequester ribosomes and reduce translation efficiency.

The energy system is another common cause of low yield. If the energy substrate is old or degraded, ATP regeneration will be inefficient. The ATP and GTP concentrations should be checked, and fresh stocks should be prepared. The magnesium concentration should be re-titrated, as the optimal concentration can shift with changes in the extract batch or the DNA concentration.

The extract itself may be the problem. Extracts that have been freeze-thawed multiple times lose activity. Extracts should be stored at −80°C in single-use aliquots and thawed on ice immediately before use. The extract should also be tested for nuclease activity by incubating it with a known DNA template and checking for degradation by gel electrophoresis.

### Protein folding problems

Protein insolubility is a common problem, particularly for proteins that are difficult to express in vivo. The first line of defense is to lower the reaction temperature to 25°C or 30°C, which slows translation and gives the protein more time to fold. The addition of chaperones (GroEL/GroES, DnaK/DnaJ/GrpE) can also improve folding. For proteins with disulfide bonds, the addition of oxidized glutathione and PDI is essential.

If the protein aggregates, the addition of a mild detergent such as Brij-35 (0.05%) or Triton X-100 (0.1%) can help keep the protein soluble. For membrane proteins, the addition of lipids or detergents is required from the start of the reaction. If the protein is completely insoluble, it may be necessary to produce it as a fusion with a solubility tag, such as maltose-binding protein (MBP) or glutathione S-transferase (GST), and cleave the tag after purification.

### Reproducibility issues

Batch-to-batch variability is a known issue in CFPS. The extract is the main source of variability, as the quality depends on the growth conditions of the cells, the lysis method, and the handling of the extract. To minimize variability, it is important to prepare extracts in large batches and to thoroughly characterize each batch before use. A standard test reaction, using a well-characterized template such as GFP, should be run with each new extract batch to establish a baseline yield.

The reaction conditions should be standardized as much as possible. Use the same buffer stocks, the same amino acid mixture, and the same energy substrate for all reactions. If possible, prepare a master mix of all common components and aliquot it into individual reactions. This reduces pipetting errors and improves reproducibility.

## Summary and Best Practices for CFPS Users

CFPS is a powerful and versatile technology for protein production. It offers speed, flexibility, and the ability to produce proteins that are difficult or impossible to express in vivo. The key to success is to understand the system's components and to optimize the reaction conditions for each new protein.

### Key takeaways

- CFPS uses cell extracts containing the translation machinery to produce proteins directly from DNA templates in vitro.
- The *E. coli* system offers the highest yields and is the most cost-effective, while eukaryotic systems are better for complex proteins requiring chaperones or post-translational modifications.
- The reaction is driven by an energy regeneration system (PEP, creatine phosphate, or glucose) and requires careful optimization of magnesium, potassium, and temperature.
- The open nature of CFPS enables direct manipulation of the reaction environment, including the addition of chaperones, oxidizing agents, detergents, and non-standard amino acids.
- CFPS is ideal for high-throughput screening, production of toxic or membrane proteins, and incorporation of non-standard amino acids.
- Common problems include low yield, protein insolubility, and batch variability, all of which can be addressed by systematic optimization.

### Checklist for a successful run

1. Prepare or obtain a high-quality extract and store it at −80°C in single-use aliquots.
2. Prepare a pure DNA template (plasmid or linear) at a concentration of 0.5–1 mg/mL.
3. Set up a test reaction with a known reporter (e.g., GFP) to validate the extract and reaction conditions.
4. Titrate the magnesium concentration (8–16 mM) and template concentration (5–50 nM) for each new protein.
5. Add folding additives (chaperones, GSSG/GSH, detergents) as needed for the target protein.
6. Run the reaction at the optimal temperature (30°C for *E. coli*, 25°C for eukaryotic systems) for 2–4 hours.
7. Quantify the yield by fluorescence (for GFP fusions), SDS-PAGE, or activity assay.
8. Characterize the product by mass spectrometry or other methods to confirm identity and quality.

## Frequently Asked Questions

### What is cell-free protein synthesis?

Cell-free protein synthesis (CFPS) is a method for producing proteins in vitro using the extracted transcriptional and translational machinery of a cell. The reaction combines a cell extract containing ribosomes, tRNAs, and translation factors with a DNA template, amino acids, nucleotides, and an energy source to drive protein production directly in a test tube.

### How does cell-free protein synthesis work?

CFPS works by coupling transcription and translation in an open, in vitro reaction. The DNA template is transcribed into mRNA by RNA polymerase (either endogenous or added T7 RNA polymerase), and the mRNA is translated into protein by ribosomes in the extract. The reaction is sustained by an energy regeneration system that maintains ATP and GTP concentrations.

### What are the advantages of cell-free protein synthesis?

CFPS offers several advantages over in vivo expression: it is faster (results in a day), it can produce toxic proteins that kill living cells, it allows direct manipulation of the reaction environment, it is highly parallelizable for screening, and it enables the incorporation of non-standard amino acids.

### What are the main components of a cell-free protein synthesis reaction?

The main components are: cell extract (containing ribosomes and translation factors), reaction buffer (containing salts and pH buffer), an energy regeneration system (PEP, creatine phosphate, or glucose), amino acids, nucleotides (ATP, GTP, CTP, UTP), and template DNA.

### Which cell-free systems are commonly used?

The most common systems are *E. coli* extract (highest yield, lowest cost), wheat germ extract (good for complex eukaryotic proteins), rabbit reticulocyte lysate (good for studying translation), and CHO or insect cell extracts (good for proteins requiring mammalian or insect post-translational modifications).

### How can I increase protein yield in cell-free protein synthesis?

To increase yield: optimize the magnesium and template concentrations, use a dialysis-based reaction format, lower the temperature to reduce mRNA degradation, add chaperones to improve folding, and ensure the energy regeneration system is functioning properly.

### What are common problems in cell-free protein synthesis?

Common problems include low yield (due to poor DNA quality, suboptimal magnesium, or inactive extract), protein insolubility (due to lack of chaperones or oxidizing conditions), and batch-to-batch variability (due to differences in extract quality).

### What is the difference between coupled and linked transcription-translation in CFPS?

In coupled transcription-translation, transcription and translation occur simultaneously in the same reaction, with ribosomes binding to the mRNA as it is synthesized. This is the standard mode in prokaryotic CFPS. In linked transcription-translation, transcription and translation are performed in separate steps, with the mRNA being synthesized first and then added to a separate translation reaction. This is less common but can be useful for studying translation independently of transcription.

## Key Takeaways

- CFPS is a rapid, flexible, and open in vitro method for protein production that bypasses the constraints of living cells.
- The *E. coli* system is the workhorse of CFPS, offering the highest yields and lowest cost, while eukaryotic systems provide chaperones and modifications for complex proteins.
- Reaction optimization—particularly magnesium, template concentration, and temperature—is essential for achieving high yields.
- The open nature of CFPS enables the production of toxic proteins, membrane proteins, and proteins with non-standard amino acids.
- Analytical methods such as SDS-PAGE, fluorescence, activity assays, and mass spectrometry are used to quantify and characterize CFPS products.
- Common pitfalls include low yield, protein insolubility, and batch variability, all of which can be addressed by systematic troubleshooting.
- CFPS is a powerful tool for high-throughput screening, [protein engineering](/knowledge/molecular-biology/protein-engineering), and the production of proteins that are difficult to express in vivo.

## Related Clinical & Scientific Guides

* [MAPK Pathway: Mechanism, Function, and Clinical Relevance](/knowledge/molecular-biology/mapk-pathway)
* [Mammalian Cell Culture Bioreactors: A Practical Guide](/knowledge/molecular-biology/mammalian-cell-culture-bioreactor)
* [Nucleotide Formation: Biosynthesis and Assembly of DNA/RNA Building Blocks](/knowledge/molecular-biology/nucleotide-formation)