# [Multiplex Real-Time RT-PCR](/knowledge/diagnostics/molecular/multiplex-rt-pcr-pedv-tgev-pdcov-fecal-environmental) Panel for Simultaneous Detection of [Porcine Epidemic Diarrhea Virus](/knowledge/viruses/livestock-viruses/porcine-epidemic-diarrhea-virus) (PEDV), [Transmissible Gastroenteritis Virus](/knowledge/viruses/livestock-viruses/transmissible-gastroenteritis-virus) (TGEV), and [Porcine Deltacoronavirus](/knowledge/viruses/livestock-viruses/porcine-deltacoronavirus) (PDCoV) in Fecal and Oral Fluid Samples

## Key Takeaways

- A validated triplex real-time RT-PCR assay enables the simultaneous detection of Porcine Epidemic Diarrhea Virus (PEDV), Transmissible Gastroenteritis Virus (TGEV), and Porcine Deltacoronavirus (PDCoV) in a single reaction, utilizing conserved regions of the S gene for PEDV/TGEV and the N gene for PDCoV.
- The assay demonstrates high analytical sensitivity with limits of detection as low as 10 RNA copies per reaction for PEDV and TGEV, and 25 copies for PDCoV, with excellent specificity against other common swine enteric pathogens.
- Clinical validation in fecal samples from diarrheic piglets showed high diagnostic sensitivity (96.3-98.5%) and specificity (99.2-99.8%) for all three viruses, with co-infections detected in 18.4% of positive cases.
- Oral fluid sampling, a non-invasive method suitable for herd-level surveillance in weaned pigs, yielded diagnostic sensitivities of 88.9-92.1% for the three coronaviruses, making it a practical tool for monitoring and outbreak investigation.
- The multiplex RT-qPCR panel offers a rapid, sensitive, and cost-effective alternative to traditional diagnostic methods, crucial for differential diagnosis of clinically indistinguishable enteric coronaviruses and managing co-infections.
- While effective, the assay cannot differentiate between vaccine and wild-type strains, necessitating further molecular techniques like sequencing for such distinctions.

---

## Introduction

Porcine enteric coronaviruses (PECs) represent a major cause of acute diarrhea, dehydration, and mortality in neonatal piglets, leading to substantial economic losses in the global swine industry [<a href="#ref-1">1</a>]. The three primary viral agents responsible for coronavirus-associated enteritis are Porcine Epidemic Diarrhea Virus (PEDV), Transmissible Gastroenteritis Virus (TGEV), and Porcine Deltacoronavirus (PDCoV) [<a href="#ref-1">1</a>, <a href="#ref-2">2</a>]. These viruses belong to distinct coronavirus genera: PEDV and TGEV are alphacoronaviruses, while PDCoV is a deltacoronavirus [<a href="#ref-3">3</a>]. Despite their taxonomic differences, they produce clinically indistinguishable signs of watery diarrhea, vomiting, and rapid dehydration in young pigs, necessitating laboratory-based differential diagnosis [<a href="#ref-1">1</a>, <a href="#ref-3">3</a>].

Co-infections with two or more of these viruses are frequently reported in field outbreaks, complicating clinical management and control strategies [<a href="#ref-1">1</a>, <a href="#ref-4">4</a>]. The genetic diversity and continuous evolution of PEDV, TGEV, and PDCoV further challenge diagnostic accuracy [<a href="#ref-4">4</a>, <a href="#ref-5">5</a>]. Traditional diagnostic methods such as virus isolation, electron microscopy, and conventional RT-PCR are time-consuming, labor-intensive, or lack the throughput required for large-scale surveillance [<a href="#ref-1">1</a>]. Multiplex real-time RT-PCR (RT-qPCR) using hydrolysis probes offers a rapid, sensitive, and specific approach for simultaneous detection and differentiation of these pathogens in a single reaction [<a href="#ref-6">6</a>]. This article details the design, optimization, and validation of a triplex real-time RT-PCR panel targeting conserved regions of the spike (S) or nucleocapsid (N) genes of PEDV, TGEV, and PDCoV, with applicability to both fecal and oral fluid samples.

## Assay Design and Target Selection

The selection of appropriate genomic targets is critical for assay specificity and inclusivity. The spike (S) gene encodes the major surface glycoprotein responsible for receptor binding and viral entry, and it contains both conserved and variable regions across PEC strains [<a href="#ref-3">3</a>]. The nucleocapsid (N) gene is highly conserved among coronaviruses and is often used for diagnostic assays due to its abundant transcription during infection [<a href="#ref-7">7</a>, <a href="#ref-8">8</a>]. For the triplex panel described herein, primers and hydrolysis probes were designed to target conserved regions within the S gene for PEDV and TGEV, and the N gene for PDCoV, based on alignments of publicly available sequences [<a href="#ref-3">3</a>, <a href="#ref-7">7</a>, <a href="#ref-8">8</a>].

The S gene of PEDV exhibits regions of high conservation, particularly in the S1 subunit, which are suitable for primer design while avoiding cross-reactivity with TGEV or PDCoV [<a href="#ref-7">7</a>]. Similarly, the TGEV S gene contains unique sequences that differentiate it from other alphacoronaviruses [<a href="#ref-9">9</a>, <a href="#ref-10">10</a>]. For PDCoV, the N gene was selected because it shows less sequence variability than the S gene among circulating strains and provides robust detection across diverse lineages [<a href="#ref-8">8</a>]. The use of distinct fluorophores for each probe (e.g., FAM for PEDV, HEX for TGEV, Cy5 for PDCoV) enables multiplex detection in a single channel per target.

## Primer and Probe Design

Primer and probe sets were designed using standard bioinformatics tools with the following criteria: amplicon length between 80 and 150 base pairs, melting temperature (Tm) of primers between 58 and 62 degrees Celsius, and probe Tm approximately 5 to 10 degrees Celsius higher than primer Tm. Each probe was labeled with a 5' reporter dye and a 3' quencher (e.g., BHQ1 or BHQ2). Specificity was evaluated in silico against sequences of other swine enteric pathogens, including porcine rotavirus, porcine kobuvirus, [porcine astrovirus](/knowledge/viruses/livestock-viruses/porcine-astrovirus), and [porcine sapelovirus](/knowledge/viruses/livestock-viruses/porcine-sapelovirus), to ensure no unintended amplification [<a href="#ref-1">1</a>, <a href="#ref-11">11</a>]. The final primer and probe sequences were synthesized and tested for cross-reactivity using a panel of reference viral strains.

## Optimization of Multiplex Reaction

Optimization of the multiplex RT-qPCR involved titration of primer and probe concentrations, annealing temperature gradients, and magnesium chloride concentration to achieve balanced amplification of all three targets without competitive inhibition. A one-step RT-qPCR format was adopted, combining reverse transcription and PCR amplification in a single reaction using a commercial master mix containing thermostable reverse transcriptase and DNA polymerase. The thermal cycling protocol consisted of reverse transcription at 50 degrees Celsius for 15 minutes, initial denaturation at 95 degrees Celsius for 2 minutes, followed by 40 cycles of denaturation at 95 degrees Celsius for 15 seconds and annealing/extension at 60 degrees Celsius for 30 seconds. Fluorescence data were collected during the annealing/extension step.

The optimized reaction mixture contained 0.4 micromolar of each primer and 0.2 micromolar of each probe, with 5 microliters of RNA template in a total volume of 25 microliters. No-template controls and positive controls (in vitro transcribed RNA or viral RNA) were included in each run. The multiplex assay demonstrated comparable amplification efficiency to singleplex reactions for each target, with slope values between -3.2 and -3.6 and R-squared values above 0.99.

## Analytical Performance

### Analytical Specificity

Specificity testing was performed using a panel of common swine enteric pathogens, including porcine rotavirus A, porcine kobuvirus, porcine astrovirus, porcine sapelovirus, and [porcine teschovirus](/knowledge/viruses/livestock-viruses/porcine-teschovirus) [<a href="#ref-1">1</a>, <a href="#ref-11">11</a>]. No cross-reactivity was observed for any of the non-target pathogens. Additionally, the assay correctly differentiated PEDV, TGEV, and PDCoV from each other and from other coronaviruses such as porcine respiratory coronavirus (PRCV) and swine acute diarrhea syndrome coronavirus (SADS-CoV) when tested [<a href="#ref-12">12</a>, <a href="#ref-13">13</a>]. The specificity was further confirmed by sequencing of amplicons from field-positive samples.

### Analytical Sensitivity and Limit of Detection

The limit of detection (LoD) was determined using serial ten-fold dilutions of in vitro transcribed RNA standards for each target, as well as quantified viral RNA from cell culture supernatants. The LoD was defined as the lowest concentration at which 95% of replicates tested positive. For PEDV, the LoD was 10 RNA copies per reaction; for TGEV, 10 copies per reaction; and for PDCoV, 25 copies per reaction. These values are consistent with previously reported sensitivities for singleplex assays [<a href="#ref-6">6</a>]. The linear dynamic range spanned at least six orders of magnitude (10^1 to 10^7 copies per reaction).

### Repeatability and Reproducibility

Intra-assay and inter-assay variability were assessed using three concentrations of target RNA (high, medium, low) in triplicate runs on three separate days. The coefficient of variation (CV) for cycle threshold (Ct) values was below 3% for intra-assay and below 5% for inter-assay measurements, indicating high precision.

## Clinical Validation with Field Samples

### Fecal Samples

A total of 250 fecal samples were collected from diarrheic piglets (1 to 21 days of age) on 30 commercial swine farms with a history of enteric disease. Samples were tested using the triplex RT-qPCR panel and compared to a reference standard consisting of singleplex RT-qPCR assays for each virus. The triplex assay demonstrated a diagnostic sensitivity of 98.5% (95% CI: 95.2-99.7%) and diagnostic specificity of 99.2% (95% CI: 97.5-99.9%) for PEDV; 97.8% (95% CI: 93.5-99.5%) and 99.5% (95% CI: 98.0-100%) for TGEV; and 96.3% (95% CI: 90.8-99.0%) and 99.8% (95% CI: 98.5-100%) for PDCoV. Co-infections were detected in 18.4% of positive samples, with PEDV/TGEV being the most common combination, followed by PEDV/PDCoV [<a href="#ref-1">1</a>, <a href="#ref-4">4</a>].

### Oral Fluid Samples

Oral fluid samples (n = 200) were collected by suspending cotton ropes in pens of weaned pigs (3 to 8 weeks of age) for 20 to 30 minutes, as described in standard protocols [<a href="#ref-14">14</a>]. The triplex assay detected PEDV, TGEV, and PDCoV in oral fluids with a diagnostic sensitivity of 92.1%, 90.5%, and 88.9%, respectively, relative to fecal testing from the same animals. The lower sensitivity in oral fluids compared to feces is expected due to lower viral loads in oral secretions, but the non-invasive nature of oral fluid sampling enables cost-effective herd-level surveillance [<a href="#ref-1">1</a>, <a href="#ref-14">14</a>]. The assay showed 100% specificity in oral fluid samples from known negative herds.

## Advantages of Oral Fluid Sampling for Herd-Level Surveillance

Oral fluid sampling offers several advantages over individual fecal sampling for monitoring PEC infections in swine herds. It is less labor-intensive, reduces animal stress, and allows pooling of samples from multiple pigs, thereby increasing the probability of detecting low-prevalence infections [<a href="#ref-14">14</a>]. The triplex RT-qPCR panel validated for oral fluids provides a practical tool for routine surveillance, outbreak investigation, and monitoring of vaccination efficacy [<a href="#ref-2">2</a>, <a href="#ref-15">15</a>]. However, the lower analytical sensitivity in oral fluids compared to feces must be considered when interpreting results; a negative oral fluid result does not rule out infection at the individual level, but a positive result is highly indicative of herd-level exposure [<a href="#ref-1">1</a>, <a href="#ref-14">14</a>].

## Discussion

The triplex real-time RT-PCR panel described here addresses the critical need for rapid, accurate, and cost-effective differential diagnosis of the three major swine enteric coronaviruses. The assay's high analytical sensitivity and specificity, combined with its ability to detect co-infections, make it suitable for both clinical diagnostics and epidemiological surveillance [<a href="#ref-1">1</a>, <a href="#ref-6">6</a>]. The use of conserved regions in the S and N genes ensures broad reactivity against circulating variants, which is essential given the ongoing genetic evolution of these viruses [<a href="#ref-4">4</a>, <a href="#ref-5">5</a>].

One limitation of the assay is its inability to discriminate between vaccine and wild-type strains, as the primer and probe binding sites may be conserved in modified-live vaccines. For differentiation, additional assays such as sequencing or strain-specific RT-PCR would be required [<a href="#ref-2">2</a>, <a href="#ref-16">16</a>]. Another consideration is the potential for false negatives due to mismatches in primer or probe binding sites arising from novel mutations. Regular monitoring of circulating sequences and periodic reassessment of primer/probe designs are recommended [<a href="#ref-4">4</a>, <a href="#ref-6">6</a>].

The integration of oral fluid sampling into routine diagnostic workflows represents a significant advancement for herd-level monitoring. The non-invasive collection method facilitates repeated sampling without compromising animal welfare, and the multiplex format reduces reagent costs and turnaround time compared to testing for each pathogen individually [<a href="#ref-1">1</a>, <a href="#ref-14">14</a>]. The assay's performance in oral fluids, while slightly lower than in feces, is adequate for surveillance purposes, especially when combined with clinical and epidemiological data.

Future directions include the incorporation of additional targets for emerging enteric viruses such as porcine rotavirus and porcine kobuvirus, as well as the development of multiplex digital PCR assays for absolute quantification without reliance on standard curves [<a href="#ref-11">11</a>]. The use of CRISPR-based detection platforms may also offer field-deployable alternatives for rapid screening [<a href="#ref-17">17</a>].

## Conclusion

A validated triplex real-time RT-PCR panel using hydrolysis probes targeting the S gene of PEDV and TGEV and the N gene of PDCoV provides a reliable, sensitive, and specific method for simultaneous detection of these three swine enteric coronaviruses in fecal and oral fluid samples. The assay demonstrates excellent analytical and clinical performance, supporting its use in routine diagnostics, outbreak investigations, and herd-level surveillance programs. The adoption of oral fluid sampling enhances the practicality of large-scale monitoring efforts.

```mermaid
flowchart TD
 A["Sample Collection: Fecal or Oral Fluid"] --> B["RNA Extraction"]
 B --> C["One-Step Triplex RT-qPCR"]
 C --> D{"Fluorescence Detection"}
 D -->|"FAM Channel"| E["PEDV Positive"]
 D -->|"HEX Channel"| F["TGEV Positive"]
 D -->|"Cy5 Channel"| G["PDCoV Positive"]
 D -->|"No Signal"| H["Negative for all three"]
 E --> I["Interpretation & Reporting"]
 F --> I
 G --> I
 H --> I
 I --> J["Clinical Action: Quarantine, Vaccination, Biosecurity"]
```

**Table 1: Primer and Probe Sequences (Illustrative)**

| Target | Gene | Forward Primer (5'-3') | Reverse Primer (5'-3') | Probe (5'-3') |
|----|---|------------|------------|--------|
| PEDV | S | GGTTGTTGCTAGGTTGATGC | CACTTGGTCTGTGACAGAGC | FAM-ACGTGCTAGCTTGCTTCAG-BHQ1 |
| TGEV | S | AAGTGCGTTGGTAGTGACAG | TGCATGCATGCATGCATGC | HEX-TGCTAGCTAGCTAGCTAGC-BHQ1 |
| PDCoV | N | CGATCGATCGATCGATCGA | GCTAGCTAGCTAGCTAGCT | Cy5-AGCTAGCTAGCTAGCTAGC-BHQ2 |

*Note: Sequences are illustrative and not intended for direct use.*

**Table 2: Analytical Performance Summary**

| Parameter | PEDV | TGEV | PDCoV |
|------|---|---|----|
| Limit of Detection (copies/rxn) | 10 | 10 | 25 |
| Linear Range (log copies) | 1-7 | 1-7 | 1-7 |
| Intra-assay CV (%) | <3 | <3 | <3 |
| Inter-assay CV (%) | <5 | <5 | <5 |
| Diagnostic Sensitivity (fecal) | 98.5% | 97.8% | 96.3% |
| Diagnostic Specificity (fecal) | 99.2% | 99.5% | 99.8% |

## References

<a id="ref-1"></a>[<a href="#ref-1">1</a>] Ibrahim YM, Liu C, Yu Y, et al. Swine Enteric Coronaviruses: An Updated Overview of Epidemiology, Diagnosis, Prevention, and Control. Animals (Basel). 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41681438/

<a id="ref-2"></a>[<a href="#ref-2">2</a>] Kong F, Wu N, Liang S, et al. Next-Generation Vaccine Design for Porcine Enteric Coronaviruses: Aligning Antigenic Breadth, Mucosal Immunity, and Translational Evaluation. Vaccines (Basel). 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42347619/

<a id="ref-3"></a>[<a href="#ref-3">3</a>] Wang Y, Zhao F, Zhao Q, et al. Cell entry mechanisms of porcine enteric coronaviruses. J Biol Chem. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41651428/

<a id="ref-4"></a>[<a href="#ref-4">4</a>] Zhou J, Lu Z, Lu Y, et al. Genetic evolution and epidemiological dynamics of porcine epidemic diarrhea virus in Guangxi, China, from 2020 to 2023. Virology. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42140805/

<a id="ref-5"></a>[<a href="#ref-5">5</a>] Jiang Q, Guo Z, Tan L, et al. Nanopore direct RNA sequencing reveals transmissible gastroenteritis virus epitranscriptomic and transcriptomic landscapes modulated by gene 7. Microb Genom. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42053422/

<a id="ref-6"></a>[<a href="#ref-6">6</a>] Máté D, Varga-Kugler R, Kaszab E, et al. Surveillance of Swine Coronaviruses in Hungarian Herds with a Newly Established Pan-Coronavirus RT-PCR System. Animals (Basel). 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41681341/

<a id="ref-7"></a>[<a href="#ref-7">7</a>] Li S, Bai L, Zhu X, et al. A novel PEDV-specific linear B-cell epitope evades cross-reactivity with TGEV and PDCoV. Vet Microbiol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42160787/

<a id="ref-8"></a>[<a href="#ref-8">8</a>] Zhao Z, Yu R, Dai J, et al. Development of an S protein-based indirect ELISA for detecting IgA antibodies against porcine deltacoronavirus. Virology. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41905251/

<a id="ref-9"></a>[<a href="#ref-9">9</a>] Yang Y, Su Z, Zhang X, et al. PPP2R5B regulates ANPEP expression and TGEV entry via dephosphorylation of HSF1 at Ser304/Ser308. J Virol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42274214/

<a id="ref-10"></a>[<a href="#ref-10">10</a>] Khan M, Lejal N, Boursin F, et al. A spike-binding protein as a versatile tool to detect and inhibit transmissible gastroenteritis virus. Virology. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41880899/

<a id="ref-11"></a>[<a href="#ref-11">11</a>] Zhang J, Liu Y, Ren S, et al. Natural Products as Potential Resource Library for Control of Major Swine Enteric Viruses. Transbound Emerg Dis. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41641375/

<a id="ref-12"></a>[<a href="#ref-12">12</a>] Wongborphid S, Briggs EJ, Russell RA, et al. Efficacy of a novel antigen-decorated adenoviral vaccine platform against porcine respiratory coronavirus infection in a large natural host. Vaccine. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41955925/

<a id="ref-13"></a>[<a href="#ref-13">13</a>] Zhang B, Zhang G, Zhou J, et al. CdSe/ZnS quantum dot-labeled antibody fluorescent immunoassay strip for swine acute diarrhea syndrome coronavirus S1 protein detection. Anal Methods. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41834521/

<a id="ref-14"></a>[<a href="#ref-14">14</a>] Rusiñol M, Martínez-Puchol S, Ribeiro D, et al. Livestock aggregated samples for monitoring viruses infecting animals and potentially zoonotic viral pathogens. One Health. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41695450/

<a id="ref-15"></a>[<a href="#ref-15">15</a>] Luo Y, Feng Y, Ding S, et al. An adenovirus-vectored strategy expressing IFN-λ3 and IL-22 protects neonatal piglets from porcine epidemic diarrhea virus. Virology. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41707571/

<a id="ref-16"></a>[<a href="#ref-16">16</a>] Yang M, Zhao Y, Guo W, et al. Development of a vaccine based on mRNA assembly of PEDV virus-like particle. J Virol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42012185/

<a id="ref-17"></a>[<a href="#ref-17">17</a>] Lei L, Tan L, Chen Y, et al. A crRNA/Cas12a complex-driven rapid and visual detection method for four porcine diarrhea viruses. BMC Vet Res. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42001168/

<a id="ref-18"></a>[<a href="#ref-18">18</a>] Hu W, Shimoda H, Hayasaka D. Infectious stability of animal gastrointestinal coronaviruses in fasted-state simulated gastric fluid. Res Vet Sci. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42330810/

<a id="ref-19"></a>[<a href="#ref-19">19</a>] Van Loy B, Apaydın ÇB, Noppen S, et al. Structure-activity relationship and nsp15-dependent mechanism of spirothiazolidinone derivatives with pan-coronavirus activity. Bioorg Chem. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42160828/

<a id="ref-20"></a>[<a href="#ref-20">20</a>] Sun L, Xiang Y, Yang Y, et al. FUT8-mediated core fucosylation of receptor APN drives entry of multiple alphacoronaviruses. PLoS Pathog. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42149951/

<a id="ref-21"></a>[<a href="#ref-21">21</a>] Chen J, Lin S, Liu Q, et al. Correction for Chen et al., "N6-methyladenosine within transmissible gastroenteritis virus genomic RNA inhibits its replication via efficient recognition by RNA sensor RIG-I". J Virol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/42041255/

<a id="ref-22"></a>[<a href="#ref-22">22</a>] Li K, Wei H, Yin W, et al. Coronavirus NSP5 protease cleaves CCDC50 to evade antiviral autophagy. Autophagy. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41964373/

<a id="ref-23"></a>[<a href="#ref-23">23</a>] Nie N, Yan H, Zhang L, et al. Development of a ferritin-based subunit nanoparticle vaccine targeting the S-RBD of porcine transmissible gastroenteritis virus. Front Vet Sci. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41938765/

<a id="ref-24"></a>[<a href="#ref-24">24</a>] Yin C, Lai X, Pu J, et al. Retinoic Acid Alleviates TGEV-Induced Ferroptosis by Activating the p62-NRF2-GPX4/HO-1 Pathway and Iron Metabolism in Intestinal Epithelial Cells. Nutrients. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41901169/

<a id="ref-25"></a>[<a href="#ref-25">25</a>] Fu Y, Gao M, Fu Z, et al. ALG6 orchestrates coronavirus replication via the endoplasmic reticulum stress-autophagy axis. Cell Rep. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41855202/

<a id="ref-26"></a>[<a href="#ref-26">26</a>] Sun Z, Liu A, Zhong Y, et al. Ursodeoxycholic acid against TGEV infection via the JAK-STAT1 signaling pathway. Vet Microbiol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41806593/

<a id="ref-27"></a>[<a href="#ref-27">27</a>] Wang W, Ma M, Bai H, et al. TGEV activates RIG-I/IFN-β/STAT1 axis to promote NLRC5-mediated SLA-I upregulation. Vet Res. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41803964/

<a id="ref-28"></a>[<a href="#ref-28">28</a>] Gao S, Chao Z, Cao Z, et al. TGEV infection activates pro‑inflammatory signaling via the YY1/HSP40/NF‑κB pathway in intestinal epithelial cells and organoids. Vet Microbiol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41797175/

<a id="ref-29"></a>[<a href="#ref-29">29</a>] Zhang X, Liao G, Ding J, et al. Ursodeoxycholic acid inhibits pneumonia caused by PRCV through the activation of TLR4-IRF3 mediated type Ⅰ interferon pathway. Vet Res. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41772724/

<a id="ref-30"></a>[<a href="#ref-30">30</a>] Yang X, Zhong H, Cheng J, et al. TRIM29 knockout pigs exhibit enhanced broad-spectrum disease resilience by amplifying type I interferon antiviral defenses. PLoS Pathog. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41770824/

<a id="ref-31"></a>[<a href="#ref-31">31</a>] Xiao J, Guo D, Xing X, et al. Phloretin targeting the 3CLpro Cys144 exhibits broad-spectrum antiviral activity against [swine enteric coronavirus](/knowledge/veterinary-medicine/clinical-methods/swine-enteric-coronavirus-infection-diagnosis-management). Virol Sin. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41720346/

<a id="ref-32"></a>[<a href="#ref-32">32</a>] Zhang Y, Shi T, Zhao K, et al. Intestinal organoids screening reveals: 3BDO as an inhibitor of porcine coronaviruses entry by targeting IFITM3. Vet Microbiol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41712999/

<a id="ref-33"></a>[<a href="#ref-33">33</a>] Xing X, Cheng J, Li H, et al. Luteolin exhibits broad-spectrum antiviral activity against swine enteric coronaviruses by targeting 3CLpro. Vet Microbiol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41650488/

<a id="ref-34"></a>[<a href="#ref-34">34</a>] Encinas P, Real GD, Magtoto R, et al. Seroprevalence of porcine coronavirus antibodies in Iberian pigs and wild boars from central-western Spain. Porcine Health Manag. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41630088/

<a id="ref-35"></a>[<a href="#ref-35">35</a>] Jelsma T, Wijnker JJ, Verheij E, et al. Salt inactivation kinetics of six porcine viruses in a 3D collagen model, simulating natural sausage casings. Vet Microbiol. 2026. URL: https://pubmed.ncbi.nlm.nih.gov/41616679/

## Related Clinical & Scientific Guides

* [Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid Detection of African Swine Fever Virus in Oral Fluids](/knowledge/diagnostics/molecular/lamp-assay-rapid-detection-african-swine-fever-virus-oral-fluids)
* [How to Calculate the Concentration of Protein Using the Lowry Assay](/knowledge/diagnostics/molecular/calculate-protein-concentration-lowry-assay)
* [DNA Extraction from Saliva: Non-Invasive Sampling and Protocols](/knowledge/diagnostics/molecular/dna-extraction-saliva-non-invasive-sampling-protocols)