# Bioinformatics Prerequisites: What You Need to Know Before You Start Bioinformatics prerequisites are the baseline skills you need before analyzing biological data on a computer: enough [molecular biology](/blog/careers/molecular-biology) to know what the data measure, enough command-line and scripting ability to move and process files, and enough statistics to reach honest conclusions. They also include the working habits, such as version control and documented metadata, that let another person rerun your analysis and get the same result. These prerequisites matter because modern biology is a data problem before it is a hypothesis problem. A single sequencing run can produce more data than a laptop comfortably stores, and published analysis pipelines now layer machine-learning models on top of sequencing data [1]. The gap between a result you can defend and a result you merely produced almost always traces back to one of these foundations rather than to the final step. Reviewers, thesis committees, and collaborators probe them directly, and every one of them can be learned deliberately. This guide is for beginners arriving from either direction, the wet lab or the computer, because both arrive with half the toolkit. ## What Are Bioinformatics Prerequisites? Bioinformatics sits at the intersection of biology, computer science, and statistics, and its prerequisites mirror that structure. The honest answer to what bioinformatics prerequisites are is a set of seven practical areas rather than a list of software packages. Software changes every few years. The ability to inspect a file, write a small script, question a statistical claim, and document what you did does not. | Prerequisite area | What you must be able to do | Concrete example | Most often confused with | |--|--|--|--| | Molecular biology | Explain what each data type measures and where it sits in the molecular hierarchy | Knowing that RNA-seq quantifies transcripts, not protein abundance | Memorizing every signaling pathway | | Unix command line | Move, inspect, filter, and join large text files from a terminal | Counting the reads in a FASTQ file with one command | Using a point-and-click desktop tool | | Scripting (Python or R) | Read, write, and debug short scripts that process tables and sequences | Computing GC content for every sequence in a file | Pasting code you cannot explain | | Statistics | Choose a test, correct for multiple comparisons, and interpret effect sizes | Applying false discovery rate control to a 20,000-gene table | Running one t-test in spreadsheet software | | File formats and data hygiene | Recognize standard formats and keep metadata consistent | Telling FASTA, FASTQ, and BAM apart at a glance | Assuming any text file works anywhere | | Reproducibility | Version-control code, pin software versions, and script every step | Rebuilding last year's figure from a clean copy of the repository | Backing up files to a shared drive | | Machine-learning literacy | Split data honestly, report metrics, and state uncertainty | Cross-validating a classifier instead of reporting training accuracy | Treating any AI output as validated | Where you start changes what you should study first. If you come from a wet lab, the shell and scripting deliver the fastest wins, and statistics deserves scheduled weekly time. If you come from programming, biology and statistics deserve that time instead, because the failure modes there are silent. A programmer with weak statistics produces wrong answers faster than anyone. ## The Core Prerequisites, Explained ### Molecular Biology Foundations You do not need to memorize pathways. You need a working model of the molecular hierarchy that connects genome to phenotype. DNA is transcribed into RNA, RNA is translated into protein, and proteins catalyze the reactions that produce metabolites. This flow from DNA through RNA to protein is the central dogma of molecular biology. Each layer has a matching measurement technology: genome sequencing catalogs DNA variation, RNA-seq quantifies transcript abundance, mass spectrometry profiles proteins, and metabolomics captures small molecules at the functional endpoint of the cascade. [Transcriptomics](/knowledge/bioinformatics/modern-transcriptomics-bulk-single-cell-spatial) and metabolomics occupy complementary positions in this hierarchy, with [gene expression](/blog/guides/gene-expression) marking upstream regulatory dysregulation and metabolites marking downstream biochemical consequences, which is why combining them describes a disease more completely than either alone [2]. Three specific facts pay for themselves repeatedly. First, a gene is not a protein. Transcript abundance correlates imperfectly with protein abundance, so an RNA-seq result is a statement about RNA. Second, a reference genome is a coordinate system. A position such as chr7:55,000,000 means nothing without the reference build it came from, and mixing builds silently corrupts annotations. Third, most high-throughput assays measure relative abundance rather than absolute molecule counts, and that fact drives every normalization decision you will make later. Add the vocabulary that appears in every dataset: variants (differences from the reference, from single-base changes to large insertions or deletions), reads (the short sequenced fragments from a sample), alignment (placing reads onto the reference), and annotation (the table that says which coordinates are genes and what they do). ### Command-Line Fluency ![Worked example turning a FASTQ quality character into a Phred score using the Phred+33 rule and the error probability.](/article-images/illustrations/bioinformatics-prerequisites-phred-quality-calc.webp) Most bioinformatics software ships as Linux command-line tools, and most large datasets live on servers reachable only through a terminal. There is no point-and-click alternative for a 200-gigabyte alignment file on a shared cluster. The shell is therefore the first prerequisite to build, and the one with the fastest payoff. Start with these groups of commands: - Navigation and inspection: pwd, ls, cd, less, head, tail, wc - File operations: mkdir, cp, mv, rm - Text filtering: grep, cut, sort, uniq, awk, sed - Transfer and remote work: ssh, rsync, wget - Archives and compression: tar, gzip, zcat - Long-running work: a terminal multiplexer such as tmux, so a dropped connection does not kill an overnight job A FASTQ file, the standard format for raw sequencing reads, shows why the shell matters. Each read occupies four lines: ``` @SRR000001.1 1 length=40 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCC + !''*((((***+))%%%++)(%%%%).1***-+*''))** ``` Line 1 is the read identifier. Line 2 is the sequence. Line 3 is a separator beginning with +. Line 4 encodes one quality value per base as an ASCII character. Under the standard Phred+33 encoding, a character's numeric quality equals its ASCII code minus 33, and a Phred score Q is defined as -10 times the base-10 logarithm of the estimated probability that the base call is wrong. Q20 means a 1 in 100 chance of a wrong base, Q30 means 1 in 1,000, and Q40 means 1 in 10,000. The example read above is a bad one. Its quality characters decode to scores between 0 and 16, and a real pipeline would flag or trim it. Two commands turn this format into answers: ``` zcat sample.fastq.gz | head -8 zcat sample.fastq.gz | awk 'NR % 4 == 1' | wc -l ``` The first peeks at the file. The second prints every fourth line starting at line 1, the headers, and counts them, giving the read count for a 10-million-read file in seconds. Opening that file in a text editor would fail. The same pattern extends to annotations and result tables: ``` cut -f1 genes.gtf | sort | uniq -c ``` That one line counts features per chromosome in a GTF annotation file. Loops scale it across samples: ``` for f in raw_data/*.fastq.gz do printf "%s\t" "$f" zcat "$f" | awk 'NR % 4 == 2' | wc -l done ``` This prints every filename next to its read count, which is the first column of every quality report you will ever make. ### Scripting in Python and R ![Decision path asking about your nearest goal to recommend Python or R as a first language, with a note that both are used together.](/article-images/illustrations/bioinformatics-prerequisites-python-or-r-first.webp) Learn one language to working depth before touching the second. In practice the split is Python for pipelines, file wrangling, and machine learning, and R for statistics, the Bioconductor genomics packages, and publication-quality plots. Many working bioinformaticians use both in one project, passing a count matrix between them. Learn to read code before you write it, and treat error messages as information rather than insult. A short, correct script beats a long, clever one you cannot debug. Here is a complete Python example that computes GC content, the percentage of G and C bases, for a sequence: ```python def gc_content(seq): seq = seq.upper() gc = seq.count("G") + seq.count("C") return round(100 * gc / len(seq), 1) print(gc_content("GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCC")) ``` That call prints 37.5, because the 40-base sequence contains 15 G or C bases. Here is a first pass in R, ranking genes by log2 fold change, the base-2 logarithm of the treated-to-control ratio: ```r counts <- read.csv("counts.csv") counts$log2fc <- log2((counts$treated + 1) / (counts$control + 1)) top_genes <- counts[order(-counts$log2fc), ] head(top_genes) ``` The + 1 is a pseudocount that prevents taking the logarithm of zero. Treat this ranking as a sanity check, not a result. A proper differential expression analysis models the count distributions and replicate structure explicitly, which is the statistics prerequisite doing its job. ### Statistics You Will Actually Use Statistics is the prerequisite most often underestimated, from both directions. Programmers underestimate it because software will happily emit a p-value for anything. Biologists underestimate it because introductory courses rarely cover data where 20,000 hypotheses are tested at once. The working core looks like this: - Look first, test second. Plot distributions and check sample relationships before any test. - Distributions matter. Sequencing counts are overdispersed, meaning their variance exceeds their mean, and standard tools model them with a negative binomial distribution rather than a normal one. - A p-value is the probability of seeing data at least this extreme if there is no real effect. It is not the probability that the hypothesis is true, and it says nothing about effect size. - Report effect sizes and confidence intervals, because a significant p-value on a trivial effect rarely matters. - Correct for multiple testing. With 20,000 genes tested at a 0.05 threshold, roughly 1,000 genes will appear significant by chance alone. False discovery rate (FDR) control, which adjusts thresholds so the expected share of false discoveries among your calls stays low, is standard practice in genomics rather than an optional refinement. - Put covariates in the model. Batch effects, the systematic differences introduced by processing samples in different groups, along with sex, age, and sequencing depth, belong in the statistical model rather than in the discussion section. Machine-learning literacy now belongs in the prerequisite set rather than in an advanced elective. Know the difference between supervised learning, which trains a model on labeled examples such as tumor versus normal, and unsupervised learning, which finds structure without labels. Internalize the train/test discipline, evaluating a model only on data it never saw during training, and use k-fold cross-validation, which repeatedly holds out part of the data for testing, while reporting uncertainty rather than a single optimistic number [3]. Read performance claims with the standard metrics in hand. Precision is the fraction of predicted positives that are truly positive, recall is the fraction of true positives the model finds, and F1 score balances the two, while accuracy alone can hide a useless model on imbalanced data. One published workflow for classifying the liver cancer and health disparities literature demonstrated the full discipline in six phases, moving through training, validating, confirming, and error analysis before building an extraction model and applying it, and reported precision, recall, F1, and accuracy at each phase [4]. ### File Formats and Data Hygiene A handful of formats cover most of genomics, and recognizing them on sight saves hours: - FASTA: reference sequences, one header line beginning with > followed by the sequence itself - FASTQ: raw reads plus per-base quality, as above - SAM and BAM: aligned reads, where SAM is the text form and BAM its compressed binary equivalent - VCF: variant calls, one row per variant with genotype information per sample - GTF and GFF: genome annotations, one row per genomic feature with coordinates - Count matrices: genes in rows, samples in columns, ready for statistics Hygiene rules outlast any format. Keep one row per observation and one column per variable. Use stable sample identifiers that match across every file. Keep metadata, the sample sheet describing each sample's group, batch, and clinical variables, as plain data rather than as cell colors, merged cells, or filename conventions. Keep raw data read-only and make every modification through a script. Large collaborative efforts depend on this discipline, and data-management roadmaps for open science recommend precise ontologies, controlled vocabularies with defined relationships between terms, and centralized database architectures so that separate laboratories' data can be integrated into high-value datasets [3]. ## Bioinformatics Prerequisites in Action: Two Worked Examples Abstract lists stick better once you see where each item earns its place. The two workflows below, one in precision oncology and one in antimicrobial resistance, show the prerequisites doing real work. ### Example 1: A microRNA pipeline in precision oncology MicroRNAs (miRNAs) are short regulatory RNAs that dampen gene expression, and they are actively pursued as cancer biomarkers. A recent review unifies the computational arc for miRNA analysis in oncology, and every stage maps onto a prerequisite [1]: 1. Study design and metadata. Define groups, replicates, and clinical variables before the data exist. (Prerequisites: biology, data hygiene) 2. Sequencing data processing. Raw reads are quality-controlled, adapter-trimmed, meaning the short synthetic sequences ligated during library preparation are removed, and then mapped or quantified. (Prerequisites: shell, file formats) 3. miRNA discovery and quantification. Tools such as miRDeep2 identify novel miRNAs from sequencing data. (Prerequisites: command line, scripting) 4. Differential expression and pathway analysis. Statistical testing finds miRNAs that differ between conditions, and functional tools such as DIANA-miRPath trace their predicted effects across pathways. (Prerequisites: statistics, molecular biology) 5. Multi-omics integration. miRNA results are combined with other molecular layers. (Prerequisites: file formats, statistics) 6. Machine-learning layers. Supervised methods, including support vector machines (a classical method that learns a separating boundary between classes) along with convolutional and recurrent neural networks (deep-learning architectures suited to grid-like and sequential data respectively), drive miRNA signature identification, classification, and target prediction. (Prerequisites: scripting, machine-learning literacy) 7. Generative models and large language models (LLMs) are layered on to support hypothesis generation and reproducibility. (Prerequisites: machine-learning literacy, plus the judgment to treat model output as a hypothesis rather than a finding) [1] ### Example 2: From bacterial genomes to a resistance predictor Antimicrobial resistance (AMR) shows how these prerequisites become clinical tools. A study of trimethoprim resistance in Streptococcus pneumoniae, the bacterium behind pneumonia and meningitis, combined three approaches on 662 clinical genomes: a genome-wide association study (GWAS), which scans whole genomes for variants statistically linked to a trait, laboratory resistance reconstruction experiments to confirm candidate mutations, and machine-learning models predicting the minimum inhibitory concentration (MIC), the lowest antibiotic concentration that stops visible bacterial growth [5]. The analysis implicated multiple additive mutations in the folA locus, which encodes the enzyme that trimethoprim inhibits, and in the sulA locus as the basis of trimethoprim non-susceptibility. A model built on those features predicted measured MIC values within one twofold dilution 86.3 percent of the time on average [5]. The authors framed the work as a repeatable roadmap: in silico analysis (computational analysis), then wet-lab validation, then diagnostic tool building [5]. Consider what each stage demanded. Processing 662 genomes by hand is impossible, so shell and scripting carried the workload. GWAS in bacteria demands statistics beyond a simple test, because population structure, the pattern of relatedness within a species, creates false associations. The modeling stage demanded honest train/test separation. The validation stage demanded enough microbiology to grow the organism and confirm the mechanism. Nobody excels at all four, which is why collaboration is itself a prerequisite. | Pipeline stage | Prerequisites it exercises | |--|--| | Organizing raw reads and sample metadata | Command line, data hygiene | | Quality control and trimming | Command line, file formats | | Alignment, quantification, or variant calling | Command line, scripting, biology | | Statistical testing with multiple-testing correction | Statistics | | Pathway and functional interpretation | Molecular biology | | Machine-learning modeling | Scripting, train/test discipline | | Sharing code, data, and models | Reproducibility, governance | ## How These Skills Are Tested in Practice Coursework can certify attendance. The following checks certify readiness, and each maps to a real failure mode: 1. Read counting. Download a public FASTQ file and report its read count with one shell command. If you cannot, you will stall at step one of every pipeline. 2. Table joining. Merge a metadata sheet with a results table on a shared sample identifier, in Python or R, and prove that no rows were lost or duplicated. Silent row loss is how mislabeled samples propagate through an entire project. 3. Plotting and noticing. Plot per-sample read counts or expression distributions and spot the sample at half the size of the rest. Noticing is the skill, and it is trainable. 4. Statistical explanation. Explain to a non-statistician colleague what a p-value, an effect size, and an FDR-adjusted value each mean, and why the adjusted value is the one that matters in a 20,000-gene table. 5. Cold rerun. Hand a colleague your project folder and ask them to rerun the analysis on a clean machine using only your scripts, environment file, and README. If they cannot, the analysis does not fully exist yet. The fifth check predicts professional readiness most directly, because real projects are rerun, revised, and audited constantly. ## Reproducibility, Data Management, and Governance ### Reproducibility as a technical skill Reproducibility is a technical skill built from a small set of tools: - Version control with Git, so every change to code is recorded and reversible - Pinned environments with conda or similar managers, so the exact package versions are recorded and reinstallable - Workflow managers such as Snakemake or Nextflow, which express a pipeline as rules and rerun only what changed - Containers such as Docker or Apptainer, which package software with its dependencies so it behaves identically elsewhere - Notebooks used with care, because hidden cell state makes a notebook unreliable as a record of what actually ran The habit that ties them together is scripting every step, including the steps that feel too small to script, such as renaming files. Anything done by hand is a step nobody can reproduce. ### Data management before analysis [Data management](/blog/guides/data-management-basics-principles-processes-and-best-practices) decisions reach upstream of analysis, and getting them wrong is expensive to fix later. Recommendations from a working group of open-science drug discovery organizations stress precise ontologies and standardized vocabulary, centralized database architectures across laboratories, transparent and reproducible data processing, deliberate choice of data representation, careful definition of training and test sets, and explicit estimation of prediction uncertainty, with cloud computing used to build and disseminate models [3]. Translated into a single-project checklist: decide identifiers and vocabulary before collecting data, keep a living sample sheet, record processing parameters in scripts rather than in memory, and fix the train/test split before you look at outcome distributions. ### Human data: governance and ethics Human data carry obligations that code does not, and governance is a genuine prerequisite for a project rather than paperwork to file afterward. Expert consultations surrounding a pediatric rheumatology data-sharing collaboration documented the recurring barriers: lack of standardized consent, ethics review processes that are hard to align across multi-site projects, the work of building governance frameworks that satisfy institutional and regulatory requirements, differing data standards between centers, and gaps in interoperability [6]. None of those barriers yields to better statistics. The ethical layer has its own structured checklist. A roadmap for the Human Exposome Project, which aims to chart lifelong environmental exposures and their biological consequences, organizes the domains as privacy and data sovereignty, informed consent and sustained participant engagement, environmental justice, governance and oversight, and actionability with responsible return of results, alongside adherence to program goals, and translates them into practices such as dynamic or tiered consent architectures, community advisory boards, embedded ethics programs, and algorithmic fairness protocols [7]. At community scale, no single database suffices, which is why federation, connecting geographically and administratively separated data resources that differ in privacy, access, analysis, and discoverability constraints, is the recommended architecture for fields such as exposomics [8]. A student does not build federated systems in year one, but understanding why data cannot simply be pooled is part of the literacy. ## How to Learn Bioinformatics: A Practical Sequence Learning works best in a fixed order, because each stage unlocks the next. ### Stage 1: Shell and files, the first weeks Live in a terminal until navigation, redirection, pipes, and loops feel boring. Boredom is the goal. Practice on your own files, including messy ones. ### Stage 2: One scripting language, the first months Pick Python or R based on your nearest goal and go deep enough to write and debug short scripts on sequence and table problems. Problem sets built for biology, such as those on the Rosalind platform, keep the practice concrete. ### Stage 3: Statistics and a first complete analysis Take a public dataset from raw file to figure. A [small RNA-seq](/knowledge/molecular-biology/small-rna-seq) or variant dataset with published metadata is ideal. The point is the whole arc, including the dead ends, rather than the polish. ### Stage 4: Reproducible pipelines and collaboration Put the Stage 3 project under version control, pin its environment, and write the README that lets a stranger rerun it. Then contribute to a lab project or an open workflow, where review by others accelerates learning faster than any lecture. ### Choosing a bioinformatics course A good [bioinformatics course](/blog/careers/bioinformatics-courses-and-certifications-a-practical-guide) shares four traits. It makes you run commands on real raw data rather than precomputed tables. It teaches version control and environment management as first-class topics. It includes statistics with multiple-testing correction rather than treating the subject as optional. And it ends with a complete project you can show. Courses that only demonstrate tools on slides build recognition, and recognition does not survive contact with a 50-gigabyte file. ## Where the Field Is Heading Two trends are reshaping the prerequisite list. Machine learning is moving from an add-on to the core. On the representation side, methods now learn compact numerical embeddings, vectors that encode an object's features, for biological objects directly. One self-supervised method integrates [protein sequence](/blog/guides/protein-sequence), structure, gene ontology annotations, and microscope images into a single embedding per protein, trained on 96,862 proteins, and the resulting representations carried over to downstream tasks such as subcellular localization and molecular function annotation [9]. Accurate low-dimensional representation is itself a prerequisite for applying machine learning to proteins, which makes data representation, rather than model architecture, the place where the gains usually are. Large language models and generative models are entering pipelines as assistants for hypothesis generation and reproducibility support, layered on top of conventional analysis rather than replacing it [1]. Systems biology, which models diseases such as cancer as networks of interacting molecules, cells, and tissues across scales, argues for tighter coordination between modeling and data-gathering efforts so that multiscale models become genuinely predictive [10]. Multi-omics integration now spans correlation-based approaches, multiblock latent factor models, network-guided pathway fusion, and machine-learning architectures, although the applied literature systematically underreports the parameter sensitivity and reproducibility limits of these methods [2]. Machine learning is even being turned on the literature itself, with classifiers and extraction models that semiautomate knowledge synthesis across fields [4]. What does not change is the floor beneath all of it. Every advance above assumes the person running it can handle a terminal, read a script, question a metric, and document a dataset. The tools at the top of the stack will keep changing. The stack will not. ## Quick Review - The prerequisites cluster into seven areas: molecular biology, command line, scripting, statistics, file formats and hygiene, reproducibility, and machine-learning literacy. - A FASTQ record is four lines, and its quality line uses Phred encoding, where Q30 means a 1 in 1,000 chance of a wrong base. - Most bioinformatics tools are Linux command-line programs, so shell fluency pays off before anything else. - Python and R are complementary: Python for pipelines and machine learning, R for statistics and plots. - Uncorrected p-values from thousands of simultaneous tests are meaningless, so false discovery rate control is standard. - Reproducibility is technical, not moral: Git, pinned environments, scripted steps, and a README a stranger can follow. - Human data add governance prerequisites, including consent, ethics review, and data standards, that no analysis skill replaces. ## Common Mistakes and Limitations 1. Learning tools before concepts. Running a differential expression command without knowing what model sits underneath leaves you unable to spot when the model's assumptions do not fit your data. 2. Skipping the shell. GUI-only habits collapse the first time a tool exists only as a Linux binary or a dataset exceeds a spreadsheet's row limit. 3. Ignoring multiple testing. Reporting uncorrected p-values from thousands of simultaneous tests is the most common way honest-looking results become wrong. 4. Letting information leak between train and test sets. Tuning parameters, selecting features, or normalizing on the full dataset before splitting quietly inflates performance, which is why careful train/test definition and uncertainty estimation are explicit recommendations in machine-learning roadmaps [3]. 5. Reading correlation as mechanism. Even well-executed multi-omics studies face a structural gap: measured correlations between transcriptomic and metabolomic features cluster around 0.3 to 0.4, so upstream expression changes only weakly predict downstream metabolite changes, and the missing proteome layer between them is one reason [2]. 6. Ignoring pre-analytical variability. How samples are collected, processed, and stored creates differences that no statistical model can fully remove after the fact. 7. Treating governance as an afterthought. Consent language, ethics review, and data standards shape what you may analyze and share, and retrofitting them after collection is slow and sometimes impossible [6]. 8. Believing model output without validation. Generative and language models support hypothesis generation, and their proposals still need experimental or independent computational confirmation [1]. 9. Underestimating documentation. The README you skip today is the analysis you cannot rerun in six months. One boundary applies to everything above: a tutorial analysis is not a clinical or diagnostic result, and individual cases, whether patients, samples, or outbreaks, need qualified domain experts and validated workflows. ## Frequently Asked Questions ### Do I need a biology degree to learn bioinformatics? No. You need working knowledge of the central dogma and of what each data type measures, which a motivated learner picks up alongside the computational skills. Many strong bioinformaticians started from computer science or statistics and learned the biology on the job. ### Should I learn Python or R first? Either one, chosen by your nearest goal. R reaches statistical genomics and publication plots fastest, Python carries you further into pipelines and machine learning, and most practitioners end up reading both fluently. ### How much math do I need before starting? Comfort with algebra, basic probability, and [hypothesis testing](/blog/data-analysis/what-is-hypothesis-testing) covers the first year of real work. Linear algebra and calculus become useful when you reach machine learning and modeling, and you can pick them up then. ### Can I learn bioinformatics on a laptop, or do I need a cluster? A laptop is enough to start. Public datasets come in sizes a personal machine can handle, and cloud options cover the rest. Clusters matter once you join a project with large cohorts, not while you are learning. ### How long does it take to become productive in bioinformatics? Months of consistent practice, not weeks. A realistic first milestone is a complete, scripted analysis of a small public dataset within three to six months of steady effort, with fluency continuing to build for years. ### Do I need machine learning or AI skills before I start? No. The foundations of shell, scripting, statistics, and data hygiene come first, and they are exactly what the AI layers assume. Machine learning stacked on weak foundations produces confident nonsense. ## Sources 1. [MicroRNA bioinformatics in precision oncology: an integrated pipeline from NGS to AI-based target discovery.](https://pubmed.ncbi.nlm.nih.gov/41168533/) 2. [Integrating Transcriptomics and Metabolomics for Clinical Disease Detection: A Critical Review of Emerging Diagnostic Methodologies.](https://pubmed.ncbi.nlm.nih.gov/42765713/) 3. [A data science roadmap for open science organizations engaged in early-stage drug discovery.](https://pubmed.ncbi.nlm.nih.gov/38965235/) 4. [Machine Learning Approach to Facilitate Knowledge Synthesis at the Intersection of Liver Cancer, Epidemiology, and Health Disparities Research.](https://pubmed.ncbi.nlm.nih.gov/35623021/) 5. [Holistic understanding of trimethoprim resistance in Streptococcus pneumoniae using an integrative approach of genome-wide association study, resistance reconstruction, and machine learning.](https://pubmed.ncbi.nlm.nih.gov/39120145/) 6. [A roadmap for navigating child health research data sharing across Canada and beyond - building on UCAN CAN-DU.](https://pubmed.ncbi.nlm.nih.gov/40898230/) 7. [Charting exposomethics: a roadmap for the ethical foundations of the human exposome project.](https://pubmed.ncbi.nlm.nih.gov/41547936/) 8. [A roadmap to advance exposomics through federation of data.](https://pubmed.ncbi.nlm.nih.gov/39267798/) 9. [Learning High-Resolution Protein Embeddings from Multimodal Data via Self-Supervised Integration.](https://pubmed.ncbi.nlm.nih.gov/42312747/) 10. [A Roadmap for the Future of Systems Biology in Cancer Research.](https://pubmed.ncbi.nlm.nih.gov/41091803/)