# Adapter Contamination in RNA-seq: Detection, Trimming, and Prevention Adapter contamination is one of the most common RNA-seq errors you will meet at the start of a project, and one of the easiest to handle badly. When sequencing reads are longer than the DNA fragments in your library, the sequencer keeps reading past the insert and into the adapter oligo that was ligated onto the fragment end. Those trailing adapter bases then look like mystery sequence at the tails of your reads. By the end of this guide you will be able to quantify adapter contamination in your own RNA-seq data, identify the correct adapter sequence for your library kit, trim reads with cutadapt and fastp without destroying paired-end structure, verify the result with FastQC and alignment-level checks, and recognize the biological sequences that inexperienced analysts often mistake for adapters. [Preprocessing](/blog/data-analysis/what-is-data-preprocessing) is now the most time-consuming stage of many RNA-seq analyses, which is why dedicated tools that remove adapters and contamination in one pass have become standard [1]. To follow the worked examples you need a Linux or macOS environment with these tools installed: ```bash conda install -c bioconda fastqc multiqc cutadapt fastp samtools seqkit ``` You also need a raw FASTQ file pair. Every example below assumes paired-end Illumina reads named `sample_R1.fastq.gz` and `sample_R2.fastq.gz`. ## What Adapter Contamination Actually Is Illumina RNA-seq libraries are built by fragmenting RNA-derived cDNA, ligating adapter oligonucleotides to both ends, and size-selecting fragments before sequencing. Size selection is never perfect. Fragments shorter than the read length, including adapter dimers where two adapters ligated to each other with no insert at all, survive into the run. When the sequencer reaches the end of a short insert it continues into the adapter sequence, so the read contains genuine insert bases followed by adapter bases. In a typical Illumina mRNA library the 3' adapter carries the sequencing primer binding site, so adapter read-through almost always appears at the 3' end of read 1 and read 2. The adapter sequence depends on the library kit, not on the sequencer. Common sequences include: | Kit or chemistry | Adapter type | Sequence (3' adapter) | |--|--|--| | Illumina TruSeq, universal | mRNA and total mRNA-seq | AGATCGGAAGAGC | | Illumina TruSeq, full read 1 | mRNA-seq | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | | Illumina TruSeq, full read 2 | mRNA-seq | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | | Illumina Nextera / Nextera XT | tagmentation-based | CTGTCTCTTATACACATCT | | Illumina small RNA (3' adapter) | miRNA and small RNA | TGGAATTCTCGGGTGCCAAGG | | Oligo(dT)-primed libraries | poly(A) tail read-through | AAAAAAAAAAAAAAAA | Two facts make adapter contamination a genuine RNA-seq problem rather than a cosmetic one. First, adapter tails do not align to the genome or transcriptome, so heavily contaminated reads produce many soft-clipped or unmapped alignments. Second, if the adapter portion is long enough, some short fragments align poorly or not at all, which biases your quantification toward longer inserts. For small [RNA sequencing](/blog/guides/rna-sequencing) the problem is severe because many miRNA reads are shorter than the adapter, so without trimming almost nothing aligns. There is also a subtler point that trips up experienced analysts. Not every untemplated tail at the end of a read is adapter. A large survey of strand-specific RNA-seq data across 54 samples found that soft-clipped sequence, meaning unmapped bases left at read ends by the aligner, was common in both major library types, predominantly 1 to 6 nucleotides long, guanine-rich, and located at the 3' end in 84.9 to 93.8 percent of cases. Random priming, not adapter contamination, drove the high levels of 3' soft-clipping on both strands, while non-random priming kept levels below 1.5 percent [2]. If you trim assuming every tail is adapter, you will shave legitimate sequence off reads and occasionally corrupt biology. ## Step-by-Step Detection of Adapter Contamination ### Step 1. Run FastQC on the raw reads ```bash mkdir qc_raw fastqc sample_R1.fastq.gz sample_R2.fastq.gz -o qc_raw multiqc qc_raw -o qc_raw ``` Open the MultiQC report and look at three modules. **Adapter Content.** FastQC plots cumulative adapter detection across the read. In a clean library the line stays near zero across the full read length. Contamination shows the curve rising toward the 3' end. FastQC tests a fixed panel of common Illumina adapters, so a nonstandard or partially degraded adapter may not register here even when it is present. **Overrepresented Sequences.** FastQC flags any sequence that appears in more than 0.1 percent of reads. Adapter dimers and poly(A) reads land here. Paste a flagged sequence into a local alignment or BLAST-like search against your adapter list. An exact or near-exact match to AGATCGGAAGAGC confirms read-through from the TruSeq adapter. **Per-base sequence content and quality.** Severe 3' quality collapse often accompanies adapter contamination because adapter-containing reads correspond to short inserts that cluster late. A practical threshold many pipelines use: if the Adapter Content module exceeds roughly 5 to 10 percent by the end of the read, or if overrepresented sequences match adapters, trimming is warranted. Below that, the effect on alignment and quantification is usually negligible for standard mRNA-seq, and you should verify with alignment-level checks before spending reads on trimming. ### Step 2. Get an exact read-through count with cutadapt Cutadapt can run in detection mode. Give it your candidate adapter and read the report without writing output files: ```bash cutadapt -a AGATCGGAAGAGC -e 0.1 --report=full \ sample_R1.fastq.gz > cutadapt_report.txt ``` The key lines of the report look like this: ``` Total reads processed: 20,000,000 Reads with adapters: 1,310,000 (6.6%) Reads that were too short: 0 (0.0%) Reads written: 20,000,000 (100.0%) Adapter 1: AGATCGGAAGAGC Sequences trimmed at 3' end: counts Length Count Percentage 1 141,532 0.7% 2 63,102 0.3% ... ``` This report tells you two things at once: what fraction of reads contain adapter, and the length distribution of the adapter portion. A distribution dominated by lengths of 1 to 10 bases is typical of mild over-reading into adapters. A spike at lengths of 30 or more bases signals adapter dimers or very short inserts, which trimming alone cannot fully fix. For paired-end detection, run cutadapt on both files with both adapters: ```bash cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \ -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \ --report=full \ sample_R1.fastq.gz sample_R2.fastq.gz > cutadapt_pe_report.txt ``` ### Step 3. Check soft clipping at the alignment level ![Decision path that sorts soft-clipped read tails into adapter read-through, random-priming artifacts, spliced leaders or rRNA ends before trimming.](/article-images/illustrations/adapter-contamination-rna-seq-tail-triage.webp) Adapter contamination can also be confirmed after a rough alignment, and this step catches tails that FastQC and cutadapt miss, including the guanine-rich priming artifacts described above. Align a subsample, then extract the 3' soft-clipped bases and count them: ```bash seqkit sample -p 0.05 -s 42 sample_R1.fastq.gz | \ seqkit seq -Q 0 > sub.fq # 5% subsample for speed hisat2 -x GRCh38 -U sub.fq -S sub.sam 2> hisat2.log samtools view sub.sam | awk '{ if ($6 ~ /[0-9]+S$/) { match($6, /[0-9]+S$/) len = substr($6, RSTART, RLENGTH) - 1 len = substr($6, RSTART, RLENGTH) gsub(/S$/, "", len) tail = substr($10, length($10) - len + 1, len) print tail } }' | head -20000 | sort | uniq -c | sort -rn | head -20 ``` Two distinct signatures tell you what you are looking at. Exact repeats of a known adapter sequence confirm adapter contamination. A smear of guanine-rich short tails of 1 to 6 bases at the 3' end matches the random-priming artifact documented in strand-specific libraries [2], and trimming it as if it were adapter will not align to any adapter sequence. Spliced leader sequences in organisms such as nematodes and trypanosomes also appear as biological 5' tails, and pipelines such as SLIDR deliberately assemble candidate spliced leaders from those 5' read tails after alignment rather than discarding them [3]. Trimming a spliced leader as adapter destroys the very signal those pipelines need. ## Step-by-Step Trimming Workflow ### Step 1. Choose the adapter sequences for your kit Use the exact full-length adapter sequences from your library preparation documentation, not short motifs copied from forum posts. If you do not know the kit, the safest practical default for standard Illumina mRNA-seq is the TruSeq pair used in the paired-end example above. For tagmentation kits such as Nextera, the transposase adapter CTGTCTCTTATACACATCT can appear at either end, which changes your trimming strategy. If the library was oligo(dT)-primed, some reads will run off the 3' end of the transcript into the poly(A) tail. These are not adapters in the kit sense, but they produce the same alignment problem and need the same treatment. ### Step 2. Trim with cutadapt, paired-end aware ```bash cutadapt \ -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \ -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \ -m 25 --pair-filter=any \ -j 8 \ -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \ sample_R1.fastq.gz sample_R2.fastq.gz \ 2> cutadapt.log ``` Parameters that matter: - `-a` and `-A` set the 3' adapters for read 1 and read 2 respectively. - `-m 25` discards read pairs where either read falls below 25 bases after trimming. Without this, fragments that were mostly adapter become near-empty reads that waste downstream memory. - `-pair-filter=any` means a pair is dropped if either mate fails the length filter, keeping the two FASTQ files synchronized. Losing this setting is a classic RNA-seq error that silently desynchronizes R1 and R2. - `-j 8` sets worker threads. - The default minimum overlap is 3 bases with an error rate of 0.1 by default, which is conservative enough for standard libraries. For poly(A) read-through, add a second 3' adapter: ```bash -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \ -a A{30} \ ``` Cutadapt supports the notation `A{30}` for a run of 30 adenines, trimming the adapter-polyA composite when both occur together. Be aware that trimming a pure poly(A) run will also clip real adenine runs at the 3' end of transcripts, which is usually acceptable for gene-level counting but not harmless for every analysis. ### Step 3. Or trim with fastp for speed and automatic detection Fastp is faster than cutadapt and includes adapter auto-detection for paired-end data: ```bash fastp \ -i sample_R1.fastq.gz -I sample_R2.fastq.gz \ -o trimmed_R1.fastq.gz -O trimmed_R2.fastq.gz \ --detect_adapter_for_pe \ --cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \ --length_required 25 \ --thread 8 \ -h fastp_report.html -j fastp.json ``` Fastp writes an HTML report showing the adapters it detected and removed. Always read that report. Auto-detection infers the adapter from read overlap analysis, and on unusual library types it can infer a sequence that is not your actual adapter, so the detected sequence should match your kit documentation. For troubleshooting runs where you need exact control, cutadapt remains the reference implementation. ### Step 4. Re-run QC on the trimmed reads ```bash mkdir qc_trimmed fastqc trimmed_R1.fastq.gz trimmed_R2.fastq.gz -o qc_trimmed multiqc qc_raw qc_trimmed -o qc_trimmed ``` The MultiQC report now overlays raw and trimmed samples. Three checks confirm success: 1. The Adapter Content curve stays flat at or near zero across the read. 2. Total reads survive at a plausible rate. For a healthy mRNA-seq library with normal insert sizes, expect to retain the large majority of reads. A loss of more than a few percent of pairs usually means many adapter dimers were present, and you should also flag the library at the wet-lab level. 3. The length distribution shifted downward by roughly the average adapter tail length, and no spike remains at the minimum length cutoff. ### Step 5. Align and confirm at the mapping level ```bash hisat2 -x GRCh38 -1 trimmed_R1.fastq.gz -2 trimmed_R2.fastq.gz \ | samtools sort -o trimmed.bam samtools flagstat trimmed.bam ``` Compare the overall and properly paired alignment rates before and after trimming. A modest improvement in the overall alignment rate is expected for contaminated libraries. If the alignment rate did not move, the contamination was mild and trimming was unnecessary for alignment purposes, though it may still matter for splice junction or variant discovery. ## Choosing Between Tools | Tool | Adapter input | Paired-end auto-detect | Best used for | Watch out for | |--|--|--|--|--| | cutadapt | Exact sequences, including `A{30}` syntax | No | Reference-standard trimming with full control | Slower than fastp on large cohorts | | fastp | Auto-detection or explicit `-adapter_sequence` | Yes | Fast cohort-wide trimming with quality filtering | Read the detected-adapter report, auto-detection is not infallible | | Trim Galore | Wraps cutadapt, auto-detects standard Illumina adapters | Yes | Quick sensible defaults | Less transparency than running cutadapt directly | | BBDuk | Adapter reference FASTA, k-mer based | Yes | Trimming both adapters and contaminant organisms in one pass | K-mer trimming behaves differently from overlap trimming | | FastqPuri | Built-in adapter and contamination removal | Yes | One-pass preprocessing with dataset-level QC reports | Newer tool, smaller community than cutadapt | FastqPuri deserves mention because it was designed specifically for RNA-seq preprocessing at scale. It produces quality reports at both the sample and dataset level with plots intended to support decisions about quality filtering, and it removes adapters and biological contamination in a single efficient pass for both single-end and paired-end compressed or uncompressed FASTQ input [1]. Dataset-level reporting is what you want when processing a cohort, because it lets you spot one outlier library with abnormal adapter levels before that library contaminates your group comparison. ## Special Cases in RNA-seq ### Small RNA sequencing Small RNA reads are frequently shorter than the adapter, so the adapter occupies the majority of many reads. Trimming here is not optional, it is the difference between a working and a non-working experiment. Use the small RNA 3' adapter sequence TGGAATTCTCGGGTGCCAAGG with cutadapt, set a permissive minimum length such as 15 bases, and never apply paired-end logic to what is a single-end assay. ### Strand-specific libraries and random priming artifacts The soft-clipping survey mentioned earlier found that second-strand-specific libraries carried significantly more soft-clipped reads than the other library type, with a P value below 0.0001, and that random priming produced high-level 3' soft-clipping on both mitochondrial strands while non-random primers kept it under 1.5 percent [2]. Two practical consequences follow. First, when you see guanine-rich 3' tails after alignment, do not add them to your adapter list. Second, when a new library prep protocol is being chosen at the wet-lab stage, the priming strategy itself is an adapter-contamination prevention decision, not just a biology decision. Alternative polyadenylation analysis is especially sensitive to 3' end artifacts, because APA methods must deconvolve overlapping cleavage and polyadenylation sites and already contend with noisy 3' UTR coverage in bulk RNA-seq data [4]. If your project will feed an APA analysis, over-aggressive poly(A) trimming near real transcript 3' ends can shift apparent cleavage sites, so trim adapters conservatively and validate the poly(A) handling on a known subset of transcripts. ### Non-model organisms and spliced leaders In organisms with trans-splicing, a fraction of transcripts carry a spliced leader exon at the 5' end that has no counterpart in the genome, so aligners report it as a 5' tail. SLIDR assembles candidate spliced leaders from exactly those 5' read tails and verifies them against SL RNA gene motifs, while SLOPPR quantifies trans-splicing events genome-wide [3]. If adapter trimming is configured to also hard-trim any unaligned 5' tail, you erase the input those methods need. For such organisms, restrict trimming to known 3' adapters and let a spliced-leader-aware workflow handle 5' biology. ### rRNA-derived reads and contamination [Ribosomal RNA](/knowledge/bioinformatics/ribosomal-rna-structure-taxonomic-profiling) fragments are the most common biological contamination in RNA-seq. Reads derived from rRNA can themselves end in characteristic sequences, and high-throughput RNA-seq reads have been used to map the mature 3' boundary of the 16S rRNA in Escherichia coli and Bacillus subtilis, resolving prior discrepancies in the reported 3' terminus [5]. The lesson for trimming is that some terminal sequence homogeneity in your data reflects real molecules, not adapters. Tools that separate adapter removal from contaminant-sequence filtering, such as FastqPuri, make this distinction operationally because contaminant filtering is based on reference sequences rather than on the adapter list [1]. ## Effects on Downstream Analysis ![Worked calculation converting 6.6 percent adapter-containing pairs out of 20 million into 1.32 million pairs with an 8 base median tail.](/article-images/illustrations/adapter-contamination-rna-seq-readthrough-scale.webp) For standard gene-level quantification, modern aligners and pseudoaligners tolerate residual adapter tails. STAR soft-clips by default, HISAT2 soft-clips, and Salmon-style selective alignment is robust to short unaligned tails. This is why mild adapter contamination, on the order of a few percent of reads with short tails, has little measurable effect on gene counts. Where adapter contamination genuinely hurts: - **Splice junction discovery.** Adapter tails create artificial clipped sequence that can be misread as novel junction evidence, particularly at short introns and in transcripts with weak coverage. - **Variant calling from RNA-seq.** Mismatches inside adapter-derived tails that partially align can seed false positive calls, so trimming plus hard-clipping of soft-clipped residues is standard for RNA-seq variant callers. - **Small RNA and 3'-end-focused assays.** These fail outright without trimming, as noted above. - **Analysis of soft-clipped sequence as signal.** Any method that reads biological meaning out of clipped bases, from mitochondrial cleavage site discovery [2] to spliced leader discovery [3], requires that you do not pre-destroy the tails. A worked example of the scale involved. Suppose your cutadapt report shows 6.6 percent of 20 million read pairs contain adapter, with a median adapter tail of 8 bases. That is 1.32 million pairs, most of which still align fine because 8 soft-clipped bases fall within aligner tolerance. The expected gain from trimming is a fraction of a percent of additional aligned pairs. Contrast a small RNA library where 60 percent of reads carry 20 or more adapter bases. There, trimming converts most of the library from unmappable to mappable, and skipping it is a fatal RNA-seq error, not an optimization. ## Prevention at the Library and Pipeline Level Adapter contamination is mostly a wet-lab variable before it is a computational one. Insert size distribution measured by Bioanalyzer or TapeStation before sequencing predicts read-through directly. A library with a mean fragment size comfortably above the read length plus adapter length will show little contamination. A library pushed through size selection to preserve scarce material will show a short-fragment shoulder that becomes adapter contamination at scale. Overamplification during PCR enriches adapter dimers, which appear in FastQC as extremely short inserts with adapter across nearly the whole read. Pipeline-level prevention means doing the same QC and trimming decisions the same way across an entire cohort. Standardized preprocessing matters for any analysis that pools samples later. Large dual-platform meta-analyses of RNA-seq and microarray data rely on consistent preprocessing and QC before harmonizing heterogeneous datasets [6], and even gene symbol harmonization before data integration is framed explicitly as a quality-control step that rescues genes that would otherwise be silently lost between datasets [7]. Adapter handling is the earliest of those QC steps, and inconsistency there propagates into every merged count matrix. A preprocessing framework that produces dataset-level adapter reports, such as FastqPuri, supports exactly this kind of cohort-level decision making [1]. A concrete protocol for prevention: 1. Record the library kit, adapter sequences, read length, and priming strategy in the project metadata file before analysis begins. 2. Run FastQC on every raw FASTQ file at intake, before any other step, and aggregate with MultiQC. 3. Set a written decision rule, for example trim if adapter content exceeds 5 percent at read end or if overrepresented sequences match known adapters, and apply it uniformly. 4. When commissioning libraries, request the insert size distribution trace and reject or renegotiate libraries dominated by fragments shorter than the read length. 5. For strand-specific protocols, note the priming scheme, since random priming generates guanine-rich 3' tails that mimic contamination [2]. ## Common Mistakes and Limitations **Trusting auto-detection without reading the report.** Fastp reports the adapter sequence it inferred. If that sequence does not match your kit, stop and investigate rather than accepting the output. Auto-detection failures are a common source of silent RNA-seq error. **Assuming every unaligned tail is adapter.** Random-priming artifacts are short, guanine-rich, 3'-biased, and prevalent in certain strand-specific library types, and they will not match any adapter sequence [2]. Spliced leaders are genuine exons from elsewhere in the genome and are the input to dedicated discovery methods [3]. Treat unknown tails as a question, not as garbage. **Losing pair synchronization.** Trimming R1 and R2 independently, or forgetting `-pair-filter=any` in cutadapt, produces FASTQ files whose read order no longer matches. Most aligners will either fail loudly or, worse in older tool versions, silently mispair. Always trim paired-end data in a single paired-end command. **Trimming poly(A) too aggressively.** Pure adenine-run trimming will also remove genuine 3' genomic sequence. For gene counting the error is diluted, but for 3' end analyses such as APA, where methods already battle overlapping cleavage sites and noisy 3' UTR coverage [4], it is a real bias. **Trimming after QC decisions that already dropped reads.** If you filter reads before trimming based on quality, short adapter-containing reads may be disproportionately dropped or kept depending on your filter, distorting the library composition. Trim first, then filter on the trimmed reads, then run alignment. **Using the wrong adapter orientation.** Some FASTQ generation pipelines emit reads reverse-complemented relative to the original library orientation, which swaps which file carries which adapter. If your cutadapt report shows near-zero adapter detected while FastQC clearly shows contamination, orientation is the first thing to check. **Trimming as a substitute for fixing the library.** Heavy adapter dimer contamination means short inserts dominated the pool. Trimming recovers the surviving pairs but cannot restore the inserts that never existed, and it inflates apparent duplicate rates. Report the library to the core facility and treat the trimmed data as the best available, not as equivalent to a clean library. **No documentation.** A trimming step with unrecorded parameters cannot be reproduced. Record the tool version, exact command line, and adapter sequences in the project log, alongside the adapter detection numbers from the raw data. One honest limitation applies throughout. Adapter handling decisions interact with kit, organism, insert size, and analysis goals in ways that no single rule covers, and individual datasets sometimes need case-by-case judgment from someone who can inspect both the sequencing data and the library records. ## Frequently Asked Questions ### Do I always need to trim adapters in RNA-seq? No. If FastQC shows adapter content near zero and your cutadapt detection run finds adapter in only a small fraction of reads with short tails, trimming is optional for standard gene-level analysis because aligners soft-clip those tails. Trim when contamination is visible, when reads are shorter than the library inserts, or when your downstream analysis is sensitive to read ends. ### How do I know which adapter sequence my data has? Check the library preparation documentation from the kit used, which lists the exact sequences, then confirm against overrepresented sequences in FastQC. If kit information is missing, align a subsample and extract the soft-clipped tails, since the repeated sequence at the 3' end is almost always the adapter. ### Is fastp adapter auto-detection reliable enough to use alone? It works well for standard paired-end Illumina libraries, but it infers the adapter from overlap analysis rather than knowing your kit. Always read the fastp HTML report and confirm the detected sequence matches your documented adapter, and fall back to explicit sequences in cutadapt when they disagree. ### Does adapter trimming change differential expression results? Usually not meaningfully for gene-level counts with mild contamination, because soft clipping and pseudoalignment already tolerate short tails. It can matter when contamination is heavy enough to reduce alignment rates, and it matters most for small RNA, splice junction, variant calling, and read-end analyses. ### Why do I still see soft clipping after trimming? Soft-clipped tails after trimming usually come from non-adapter sources. Random priming produces guanine-rich 3' tails that do not match adapter sequences, especially in certain strand-specific library types, and biological 5' leaders appear in organisms with trans-splicing. Check the tail sequences before adding anything to your adapter list. ### Should I trim polyA tails from oligo(dT)-primed libraries? Yes, if reads run off the transcript 3' end into the poly(A) tail, because those bases do not align. Use a bounded run such as cutadapt's A{30} syntax and be aware that genuine adenine-rich transcript ends can also be clipped, which matters for analyses focused on 3' ends. ### What percentage of adapter contamination is acceptable? There is no official cutoff. Many pipelines act when adapter content exceeds several percent by read end, while libraries with minimal read-through need no trimming at all. The right question is whether trimming measurably improves alignment or your specific downstream analysis, which you verify by comparing alignment rates before and after. ### Should I trim adapters before or after quality filtering? Trim adapters first, then apply quality and length filtering to the trimmed reads. Adapter trimming can shorten reads enough to change their quality profile and length, so filtering on untrimmed reads makes inconsistent decisions across libraries and can desynchronize paired-end files. ## Sources 1. [FastqPuri: high-performance preprocessing of RNA-seq data.](https://pubmed.ncbi.nlm.nih.gov/31053060/) 2. [MitoClipSplice: a machine learning framework for resolving mitochondrial RNA cleavage sites from strand-specific RNA-seq soft-clips](https://pubmed.ncbi.nlm.nih.gov/42561155/) 3. [SLIDR and SLOPPR: flexible identification of spliced leader trans-splicing and prediction of eukaryotic operons from RNA-Seq data](https://pubmed.ncbi.nlm.nih.gov/33752599/) 4. [PolyAMiner-Bulk is a deep learning-based algorithm that decodes alternative polyadenylation dynamics from bulk RNA-seq data](https://pubmed.ncbi.nlm.nih.gov/38325383/) 5. [Elucidating the 16S rRNA 3′ boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data](https://pubmed.ncbi.nlm.nih.gov/29247194/) 6. [Transcriptomic Landscape and Regulatory Pathways of Drought Response in Rice (Oryza sativa L.): A Meta-Analysis of Microarray and RNA-Seq Data](https://pubmed.ncbi.nlm.nih.gov/41977364/) 7. [geneSync: Gene Symbol Harmonization for Large-scale RNA-seq Data Integration](https://doi.org/10.64898/2026.05.04.722831)