# Pasteurella trehalosi Septicemia in Young Sheep and Bighorn: Taxonomy, Pathogenesis, Diagnosis, and Control
## Key Takeaways
- *Bibersteinia trehalosi* (formerly *Pasteurella trehalosi*) is a significant cause of acute septicemia and mortality in young domestic sheep and bighorn sheep, often presenting as sudden death with fibrinous polyserositis.
- The organism is distinguished from *Mannheimia haemolytica* and *Pasteurella multocida* by its trehalose fermentation (positive), non-hemolytic colonial morphology on blood agar, and a distinct leukotoxin (Lkt) genotype.
- Diagnosis relies on a combination of phenotypic identification (trehalose fermentation, Gram stain) and definitive molecular confirmation via PCR targeting the *lkt* gene or species-specific 16S rRNA sequences.
- Stressors such as weaning, transport, and concurrent viral infections predispose young sheep to *B. trehalosi* septicemia, while bighorn sheep are highly susceptible, with epizootics leading to severe population declines.
- Antimicrobial resistance is an emerging concern, necessitating *in vitro* susceptibility testing to guide treatment with beta-lactams, tetracyclines, or macrolides; vaccination with multivalent leukotoxoid bacterins is a key preventive strategy.
- Differential diagnoses include other causes of acute septicemia and sudden death in young ruminants, such as *M. haemolytica*, *P. multocida*, and *Clostridium perfringens* type D.
---
## Introduction
Septicemic pasteurellosis due to *Pasteurella trehalosi* (reclassified as *Bibersteinia trehalosi*) is a critical cause of acute mortality in young domestic sheep (*Ovis aries*) and in free-ranging bighorn sheep (*Ovis canadensis*) [1, 2]. The disease is characterized by rapid onset of septicemia, fibrinous polyserositis, and sudden death, often without premonitory clinical signs [3]. Among the Pasteurellaceae family, *B. trehalosi* is distinguished from *[Mannheimia haemolytica](/knowledge/bacteria/livestock-bacteria/mannheimia-haemolytica)* and *Pasteurella multocida* by its trehalose fermentation pattern, its leukotoxin (Lkt) genotype, and its predilection for systemic invasion rather than primary pneumonia in young ruminants [2, 4]. In bighorn sheep populations, epizootics of pasteurellosis involving leukotoxigenic *B. trehalosi* have been linked to severe population declines, prompting research into vaccine efficacy and transmission dynamics [5, 6, 7].
This article provides an exhaustive clinical and diagnostic reference on *P. trehalosi* septicemia, covering taxonomic history, host range, virulence mechanisms, pathological findings, molecular and phenotypic identification, antimicrobial resistance patterns, and vaccination approaches. All cited evidence is drawn from the provided literature set [1, 8].
## Taxonomy and Etiology
The taxonomic history of *Pasteurella trehalosi* reflects the evolving molecular phylogeny of the Pasteurellaceae. Based on DNA-DNA hybridization and 16S rRNA sequencing, Sneath and Stevens formally proposed the reclassification of biovar T of the *Pasteurella haemolytica* complex as *Pasteurella trehalosi* sp. nov. [4]. This taxon was later transferred to the genus *Bibersteinia* as *Bibersteinia trehalosi*, though the older designation *Pasteurella trehalosi* persists in clinical literature [2, 4]. The organism is a gram-negative, non-motile, facultatively anaerobic coccobacillus that exhibits bipolar staining with methylene blue or Giemsa stain [4, 8]. On blood agar, colonies are small, gray, and non-hemolytic or weakly hemolytic, in contrast to the beta-hemolytic *M. haemolytica* [2]. The key biochemical feature enabling differentiation from *M. haemolytica* is the ability to ferment trehalose; *B. trehalosi* is trehalose-positive, whereas *M. haemolytica* is trehalose-negative [2, 4].
Table 1 summarizes the key phenotypic and genotypic characteristics distinguishing *B. trehalosi* from other ovine Pasteurellaceae.
**Table 1. Phenotypic and Genotypic Characteristics of Ovine Pasteurellaceae**
| Feature | *Bibersteinia trehalosi* | *[Mannheimia haemolytica](/knowledge/bacteria/livestock-bacteria/mannheimia-haemolytica)* | *Pasteurella multocida* |
|-----|-------------|-------------|-------------|
| Gram stain | Negative coccobacillus | Negative coccobacillus | Negative coccobacillus |
| Hemolysis on blood agar | Non-hemolytic / weak | Strong beta-hemolytic | Non-hemolytic |
| Trehalose fermentation | Positive | Negative | Variable |
| Leukotoxin (Lkt) | LktC-like variant | LktA (major leukotoxin) | Absent |
| Primary disease association | Septicemia in lambs; pneumonia in bighorn | Pneumonic pasteurellosis | [Fowl cholera](/knowledge/bacteria/avian-bacteria/avian-cholera-fowl-cholera-in-poultry); septicemia in lambs [8] |
| Reference | [2, 4] | [1] | [8] |
The leukotoxin of *B. trehalosi* is a pore-forming RTX toxin that targets ruminant leukocytes and is structurally distinct from the LktA of *M. haemolytica* [3]. Genetic characterization of *lkt* loci is important for molecular typing and virulence assessment [3].
## Epidemiology in Young Sheep and Bighorn Sheep
### Domestic sheep
*B. trehalosi* is a commensal of the upper respiratory tract and tonsils of healthy sheep but can cause sporadic septicemia in lambs aged 3 to 12 months under conditions of stress (weaning, transport, inclement weather, concurrent viral infection) [1, 2]. In a large cross-sectional study in Western Oromia, Ethiopia, *B. trehalosi* was detected by PCR in approximately 8% of apparently healthy sheep, though prevalence varied by flock and season [1]. Clinical outbreaks are typically associated with mortality rates of 10 to 30% in affected cohorts [1, 8]. In Egypt, an outbreak of pasteurellosis (primarily *P. multocida*, but co-infections with *B. trehalosi* are common) resulted in sudden death in 21.4% of lambs under one year, with mild respiratory signs preceding death [8].
### Bighorn sheep
Bighorn sheep (*Ovis canadensis*) are highly susceptible to pasteurellosis caused by leukotoxigenic *B. trehalosi* and *M. haemolytica* [3, 5]. Epizootics in bighorn populations can cause >50% mortality, particularly in lambs and yearlings [5]. Experimental infection of bighorn sheep with leukotoxigenic *B. trehalosi* has demonstrated rapid transmission to conspecifics and high shedding from nasal secretions, confirming the contagious nature of the infection [3]. Domestic sheep are considered potential reservoirs of *B. trehalosi* for bighorn populations, as contact between the species can lead to pathogen spillover [3, 6]. The host competency of aoudad (*Ammotragus lervia*) as a bridge host has also been investigated; aoudad experimentally infected with *B. trehalosi* shed the organism for up to 30 days and transmitted infection to bighorn lambs [3].
## Pathogenesis and Virulence Factors
The pathogenicity of *B. trehalosi* is multifactorial, with leukotoxin production being the primary virulence determinant [2, 3]. Leukotoxin (Lkt) is an RTX (repeats in toxin) cytolysin that binds to the CD18 subunit of beta-2 integrins on ovine neutrophils, macrophages, and lymphocytes, causing pore formation and osmotic lysis [3]. This results in a dysregulated inflammatory response, with release of lysosomal enzymes and reactive oxygen species that damage pulmonary endothelium and contribute to septic shock [3].
In septicemic forms, the bacteria invade the bloodstream from the upper respiratory tract or tonsillar crypts, leading to fibrin deposition on serosal surfaces (pleuritis, pericarditis, peritonitis) and diffuse intravascular coagulation [2, 8]. *B. trehalosi* produces a polysaccharide capsule that inhibits phagocytosis and complement activation [2]. Lipopolysaccharide (LPS) triggers toll-like receptor 4 (TLR4) signaling, upregulating pro-inflammatory cytokines (TNF-alpha, IL-1 beta) that mediate fever and hypotension [3, 8].
## Clinical Signs and Lesions
### Clinical presentation
In young lambs, the disease often manifests as peracute septicemia. Affected animals are found dead without prior signs, or exhibit depression, pyrexia (40 41.5 degrees C), reluctance to move, tachypnea, and mild nasal discharge [1, 8]. In bighorn lambs, the course may be prolonged; animals show serous ocular discharge, coughing, and progressive weakness [5].
### Gross pathology
Postmortem examination reveals:
- Subcutaneous and intramuscular hemorrhages in the axillary and inguinal regions.
- Fibrinous pleuritis and pericarditis with serosanguinous fluid accumulation.
- Congested, edematous lungs with firm, reddened areas of consolidation (bronchopneumonia) [8].
- Enlarged, friable liver with focal necrotic foci; histologically, hepatocellular degeneration and sinusoidal congestion [8].
- Splenomegaly with lymphoid depletion.
- Petechiae on the epicardium and kidney cortex.
### Histopathology
On microscopic examination, acute bronchopneumonia is characterized by neutrophilic infiltration of alveoli and bronchioles, fibrin exudation, and necrotic debris [8]. Gram-negative coccobacilli can be visualized in tissue sections using Giemsa or Gram stain. In the liver, centrilobular necrosis and vacuolar degeneration are common [8].
## Diagnostic Approaches
### Phenotypic identification
Conventional culture remains the first-line diagnostic method. Nasal swabs, lung tissue, liver, or heart blood collected aseptically from fresh carcasses are plated on blood agar (5% sheep blood) and [MacConkey agar](/knowledge/diagnostics/microbiology/macconkey-agar-selective-differential-enteric) [2]. After 24 48 hours at 35 degrees C in 5% CO2, colonies are identified by:
- Colony morphology: small, gray, round, non-hemolytic on blood agar.
- Gram stain: negative coccobacillus with bipolar staining.
- Biochemical profile: trehalose positive, mannitol negative, indole negative, urease negative [2, 4].
Automated systems (e.g., commercial identification strips) may misidentify *B. trehalosi* as *M. haemolytica* or *P. multocida* if trehalose fermentation is not performed [2].
### Molecular diagnostics
PCR assays targeting specific genetic markers are essential for definitive speciation [1, 8]. The 16S rRNA gene can be amplified with universal primers and sequenced for phylogenetic analysis [8]. Species-specific PCRs target the *lkt* gene for *B. trehalosi* and the *kmt1* gene for *P. multocida* [1, 8]. Real-time PCR using SYBR Green with melting curve analysis provides rapid quantitation and differentiation [8].
Table 2 lists recommended primers for *B. trehalosi* identification.
**Table 2. PCR Primers for Detection of *Bibersteinia trehalosi***
| Target gene | Primer | Sequence (5' to 3') | Amplicon size | Reference |
|-------|----|-----------|--------|------|
| 16S rRNA (universal) | 27F | AGAGTTTGATCMTGGCTCAG | ~1500 bp | [8] |
| 16S rRNA (universal) | 1492R | TACGGYTACCTTGTTACGACTT | ~1500 bp | [8] |
| *lkt* (specific) | Lkt-F | GGTATGCACAGAGACCAGCA | 342 bp | [1] |
| *lkt* (specific) | Lkt-R | CTGCCATCGTGACTTTCGTT | 342 bp | [1] |
Multiplex PCR panels that simultaneously detect *M. haemolytica*, *B. trehalosi*, and *P. multocida* are available and improve diagnostic accuracy in mixed infections [1].
### Serology
ELISA methods for detecting serum antibodies against *B. trehalosi* leukotoxin are used in surveillance and vaccine response studies [6, 7]. A multivalent *P. haemolytica* vaccine (containing leukotoxoid from both *M. haemolytica* and *B. trehalosi* components) has been evaluated in bighorn sheep; significant seroconversion (IgG) was observed after two doses [6, 7].
## Treatment and Antimicrobial Resistance
Parenteral antibiotics are critical in acute outbreaks, but their efficacy is compromised by the peracute nature of the disease; many animals die before therapy can be initiated [2]. Beta-lactams (penicillin, ceftiofur), tetracyclines (oxytetracycline), and macrolides (tulathromycin) are commonly used [2]. However, antimicrobial resistance (AMR) in *B. trehalosi* is an emerging concern. A study of bovine isolates (from BRD cases) reported resistance to tetracycline in 35%, to penicillin in 22%, and to sulfonamides in 15% of isolates [2]. Multidrug resistance (resistance to three or more drug classes) was detected in 10% of isolates [2]. Consequently, susceptibility testing by disk diffusion or minimum inhibitory concentration (MIC) determination is recommended to guide therapy.
## Prevention and Vaccination
### Vaccination in domestic sheep
Autogenous bacterins or commercial multivalent *Mannheimia*/ *Pasteurella* vaccines are used in high-risk flocks. Vaccination of ewes pre-lambing enhances colostral antibody transfer to lambs, providing passive protection during the first weeks of life [5].
### Vaccination in bighorn sheep
Given the devastating impact of pasteurellosis in bighorn populations, vaccine trials have been conducted using a multivalent *P. haemolytica* leukotoxoid bacterin (containing *B. trehalosi* antigens). In domestic sheep, the vaccine was safe and induced high antibody titers [6]. In bighorn sheep, a two-dose regimen (subcutaneous) was well tolerated, and serologic responses were comparable to those in domestic sheep [7]. However, a field trial in bighorn lambs showed variable efficacy; vaccination of ewes did not consistently increase lamb survival following natural epizootics [5]. This suggests that environmental transmission dynamics and maternal antibody interference may limit vaccine effectiveness.
## Differential Diagnosis
The differential diagnosis for acute septicemia and sudden death in young sheep includes:
- *Mannheimia haemolytica* (pneumonic pasteurellosis) [1].
- *Pasteurella multocida* (septicemic pasteurellosis) [8].
- *Clostridium perfringens* type D (enterotoxemia/pulpy kidney disease) [see link].
- *Escherichia coli* septicemia in neonates.
- Salmonellosis (*Salmonella enterica* subsp. *enterica*).
- *[Histophilus somni](/knowledge/bacteria/livestock-bacteria/histophilus-somni-bovine-thrombotic-meningoencephalitis-brd)* septicemia.
Definitive diagnosis relies on culture, PCR, and histopathological examination.
## Diagnostic Workflow
The following Mermaid diagram illustrates the recommended diagnostic algorithm for suspected *B. trehalosi* septicemia in lambs or bighorn sheep.
```mermaid
flowchart TD
A["Sudden death or acute illness in lamb/bighorn"] --> B["Field necropsy and sample collection"]
B --> C["Fresh lung, liver, heart blood, nasal swab"]
C --> D["Gram stain: bipolar coccobacilli"]
C --> E["Blood agar culture (non-hemolytic colonies)"]
C --> F["Biochemical testing: trehalose positive"]
D --> G["Presumptive diagnosis of Pasteurellaceae"]
E --> G
F --> G
G --> H["Species-specific PCR (lkt gene for B. trehalosi)"]
H --> I["Confirm B. trehalosi"]
G --> J["Multiplex PCR to rule out M. haemolytica, P. multocida"]
J --> I
I --> K["Antimicrobial susceptibility testing"]
I --> L["Histopathology for confirmation of fibrinonecrotic lesions"]
K --> M["Treat affected animals; implement biosecurity"]
L --> M
M --> N["Vaccination strategy; outbreak management"]
```
Figure 1. Diagnostic algorithm for *Bibersteinia trehalosi* septicemia in sheep.
## Conclusion
*Pasteurella trehalosi* (*Bibersteinia trehalosi*) is a primary agent of septicemic pasteurellosis in young domestic sheep and a significant pathogen in bighorn sheep epizootics. Its ability to produce a leukotoxin, evade host immune responses, and cause rapid onset of systemic disease necessitates swift and accurate diagnosis. Molecular methods, particularly PCR targeting the *lkt* gene, are superior to phenotypic tests alone for species identification. Antimicrobial resistance trends underscore the need for *in vitro* susceptibility testing prior to treatment selection. Vaccination of ewes and bighorn ewes with multivalent leukotoxoid bacterins remains the cornerstone of prevention, though field efficacy in wildlife populations is variable. Continued surveillance of *B. trehalosi* prevalence, resistance profiles, and transmission across domestic-wildlife interfaces is essential for managing this disease.
## References
[1] Kenea MG, Hambisa AB, Demiso MS. Prevalence and Molecular Detection of *Pasteurella multocida*, *Mannheimia hemolytica*, and *Bibersteinia trehalosi* in Sheep, Western Oromia, Ethiopia. *bioRxiv*. 2026. URL: https://www.semanticscholar.org/paper/10206ef8f7c08fd5ca0dd4e4020688b352b0d0e9
[2] Dewell G, Thompson C, Plummer P, et al. Identification and antimicrobial resistance of *Bibersteinia trehalosi*. *American Association of Bovine Practitioners Conference Proceedings*. 2012. URL: https://www.semanticscholar.org/paper/6cdd9f0f0b609b8200a7023ac8231ffcd1954e58
[3] Thomas LF, Clontz D, Nunez CM, et al. Evaluating the transmission dynamics and host competency of aoudad (*Ammotragus lervia*) experimentally infected with *Mycoplasma ovipneumoniae* and leukotoxigenic Pasteurellaceae. *PLoS One*. 2024. URL: https://pubmed.ncbi.nlm.nih.gov/38950318/
[4] Sneath PHA, Stevens M. *Actinobacillus rossii* sp. nov., *Actinobacillus seminis* sp. nov., nom. rev., *Pasteurella bettii* sp. nov., *Pasteurella lymphangitidis* sp. nov., *Pasteurella mairi* sp. nov., and *Pasteurella trehalosi* sp. nov. *International Journal of Systematic Bacteriology*. 1990. URL: https://www.semanticscholar.org/paper/92a40652b2a4f36346368f024eba23d611dbdb06
[5] Cassirer EF, Rudolph KM, Fowler P, et al. Evaluation of ewe vaccination as a tool for increasing bighorn lamb survival following pasteurellosis epizootics. *J Wildl Dis*. 2001. URL: https://pubmed.ncbi.nlm.nih.gov/11272504/
[6] Ward AC, Hunter DL, Rudolph KM, et al. Immunologic responses of domestic and bighorn sheep to a multivalent *Pasteurella haemolytica* vaccine. *J Wildl Dis*. 1999. URL: https://pubmed.ncbi.nlm.nih.gov/10231755/
[7] Miller MW, Conlon JA, McNeil HJ, et al. Evaluation of a multivalent *Pasteurella haemolytica* vaccine in bighorn sheep: safety and serologic responses. *J Wildl Dis*. 1997. URL: https://pubmed.ncbi.nlm.nih.gov/9391957/
[8] Abd-Elfatah EB, Salman MB, Zin Eldin AI, et al. Histopathological and Molecular Investigation of *Pasteurella multocida* Specific Outbreak in a Sheep Flock with High Mortality in Egypt. *The Iraqi Journal of Veterinary Medicine*. 2025. URL: https://www.semanticscholar.org/paper/0d4cb90529f0917af5183bbcf89a95888ff38376
## Related Clinical & Scientific Guides
* [Duck Diseases: A Comprehensive Overview for Veterinary Practitioners](/knowledge/bacteria/general/duck-diseases-comprehensive-overview-veterinary)
* [Salmonella Dublin in Cattle: Emerging Pathogen, Diagnostic Challenges, and Public Health Impact](/knowledge/bacteria/general/salmonella-dublin-cattle-emerging-pathogen-diagnostic-public-health)
* [Mycoplasma Infections in Poultry: Vaccination Strategies and Control Programs](/knowledge/bacteria/general/mycoplasma-infections-in-poultry-vaccination-strategies-and-control-programs)