Zubair Khalid

Virologist/Molecular Biologist | Veterinarian | Bioinformatician

Conventional & Molecular Virology • Vaccine Development • Computational Biology

Dr. Zubair Khalid is a veterinarian and virologist specializing in conventional and molecular virology, vaccine development, and computational biology. Dedicated to advancing animal health through innovative research and multi-omics approaches.

Dr. Zubair Khalid - Veterinarian, Virologist, and Vaccine Development Researcher specializing in Computational Biology, Multi-omics, Animal Health, and Infectious Disease Research

Section: Molecular Diagnostics

Development and Validation of a Multiplex RT-qPCR Assay for Simultaneous Detection and Subtyping of Avian Influenza Virus H5, H7, and H9 in Poultry Oral and Cloacal Swabs

Introduction

Avian influenza virus (AIV) is a segmented negative-sense RNA virus belonging to the family Orthomyxoviridae [1]. Among the 16 hemagglutinin (HA) and 9 neuraminidase (NA) subtypes circulating in avian hosts, the H5, H7, and H9 subtypes are of particular concern for poultry health and international trade [1, 2]. Highly pathogenic avian influenza (HPAI) viruses of the H5 and H7 subtypes cause severe systemic disease with high mortality, while low pathogenicity H9N2 viruses are widely endemic and can predispose flocks to secondary bacterial infections [1, 2]. Rapid and accurate subtyping of these HA subtypes is essential for outbreak containment, surveillance, and implementation of control measures [3]. The primary diagnostic samples for AIV detection in poultry are oral (oro-pharyngeal) and cloacal swabs, which contain viral RNA shed from the respiratory and enteric tracts [1].

Multiplex real-time reverse transcription quantitative PCR (RT-qPCR) assays that target the HA gene allow simultaneous identification of multiple subtypes in a single reaction, saving time, reagents, and sample volume [3]. This article provides a detailed technical overview of designing, optimizing, and validating a multiplex one-step RT-qPCR assay for the simultaneous detection and subtyping of AIV H5, H7, and H9 in poultry oral and cloacal swabs, including an endogenous internal control (e.g., beta-actin) to monitor sample quality and extraction efficiency.

Assay Design: Primers and Probes

The HA gene is the primary target for subtyping because it contains subtype-specific sequences in the HA1 domain [1]. For each subtype (H5, H7, H9) and the internal control (beta-actin), a set of forward and reverse primers and a hydrolysis probe (dual-labeled with a fluorophore and quencher) are designed. Key design parameters include melting temperature (Tm) of 58-60°C for primers and 68-70°C for probes, GC content of 40-60%, amplicon length of 80-150 base pairs, and avoidance of secondary structures and cross-dimerization [3]. Primers and probes should be checked in silico against GenBank sequences to ensure coverage of circulating genetic lineages (e.g., clade 2.3.4.4 for H5, Eurasian and American lineages for H7, and G1/Y280 lineages for H9) [1, 2]. The internal control target (beta-actin) is used to verify RNA integrity and the absence of PCR inhibitors [3].

Table 1 provides an example of primer and probe sequences (generic, not derived from any specific publication) for illustration.

Table 1. Example Primer and Probe Sequences for Multiplex RT-qPCR Targeting AIV HA Subtypes and Beta-Actin

Target Primer/Probe Sequence (5′–3′) Fluorophore/Quencher
H5 Forward ACGTATGACTATCCACATATTC
H5 Reverse AGACCAGCTACCATGATTGC
H5 Probe TCACAGAGTCGGTTCCCTTGCA FAM-BHQ1
H7 Forward AATGCACACGGAGAGGGAA
H7 Reverse TCTCCCTCCCACTCCCTTT
H7 Probe CTGGTTAAGCTGGGTGGCATC HEX-BHQ1
H9 Forward CTCCACAGAGCAATCATGG
H9 Reverse GTCACACTTGTTGTTGTRTC
H9 Probe CTCTACATTGGAGACCCTATA Cy5-BHQ2
Beta-actin Forward GGCTGTATTCCCCTCCATCG
Beta-actin Reverse GCCGATAGTGATGACCTGAC
Beta-actin Probe CCTTCCTTCCTGGGCATGGAGT Cy5.5-BHQ3

Each probe is labeled with a distinct fluorophore to enable multiplex detection in separate channels of a real-time PCR instrument. The quencher (BHQ variant) is selected to match the emission spectrum of the fluorophore [3].

Sample Preparation and RNA Extraction

Oral and cloacal swabs are collected from poultry using sterile synthetic-tipped swabs [1]. The swab tip is placed into a transport medium, typically phosphate-buffered saline (PBS) supplemented with antibiotics and protein stabilizer (e.g., 0.5% bovine serum albumin) to preserve viral RNA [3]. RNA extraction is performed using a silica-membrane-based column method or magnetic bead-based technology [3]. The extracted RNA is eluted in nuclease-free water and stored at -80°C until analysis. A non-competitive internal control (e.g., exogenous RNA or DNA) can be spiked into the lysis buffer to monitor extraction efficiency and PCR inhibition independently of the endogenous beta-actin control [3].

Optimization of the Multiplex One-Step RT-qPCR

One-step RT-qPCR combines reverse transcription and PCR in a single reaction, using a thermostable reverse transcriptase and DNA polymerase [3]. The reaction mixture includes primers and probes at optimized concentrations to balance amplification efficiency among targets. Typical initial concentrations are 400 nM for primers and 200 nM for probes, adjusted after titration [3]. Annealing temperature is optimized by performing a thermal gradient (55-65°C) and selecting the temperature that yields the lowest cycle threshold (Ct) values and highest fluorescence for all targets without non-specific amplification [3]. Multiplex balancing involves adjusting primer concentrations to minimize competition for reagents and to equalize amplification curves across targets [3]. A typical optimized 25 µL reaction contains 5 µL of RNA template, 12.5 µL of 2X master mix, primers, probes, and nuclease-free water. Thermocycling parameters: reverse transcription at 50°C for 15 minutes, initial denaturation at 95°C for 2 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds and annealing/extension at 60°C for 30 seconds (with fluorescence acquisition) [3].

Analytical Validation

Validation is performed according to guidelines from the World Organisation for Animal Health (WOAH/OIE) and the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) [3]. Key parameters include:

  • Analytical sensitivity (Limit of Detection, LOD): Determined using serial dilutions of in vitro transcribed RNA or virus stock of known titer (e.g., EID50/mL). LOD is defined as the lowest concentration detected in ≥95% of replicates [3]. For multiplex assays, LOD should be assessed for each target individually and in combination to confirm no loss of sensitivity due to multiplexing [3].

  • Analytical specificity: Evaluated by testing RNA from other avian respiratory viruses, such as Newcastle disease virus, infectious bronchitis virus, avian metapneumovirus, and adenoviruses, to confirm no cross-reactivity [1, 2]. Additionally, in silico BLAST analysis of primer/probe sequences against public databases is performed to identify potential off-target matches [3].

  • Repeatability (intra-assay precision): Assessed by testing replicate samples of known positive controls in a single run and calculating the coefficient of variation (CV) of Ct values. CV should be <5% [3].

  • Reproducibility (inter-assay precision): Assessed by testing the same panel across multiple runs on different days and by different operators, with CV <10% [3].

  • Linearity and dynamic range: Evaluated using ten-fold serial dilutions over a range of at least 5 log10 copies/reaction. The correlation coefficient (R²) of the standard curve should be >0.98 [3].

  • Efficiency: Calculated from the slope of the standard curve; acceptable range is 90-110% [3].

  • Diagnostic sensitivity and specificity: Determined by testing known positive and negative field samples (confirmed by virus isolation or sequencing) and calculating sensitivity = TP/(TP+FN) and specificity = TN/(TN+FP) [3].

Interpretation of Ct Values

A positive result for any subtype is defined by an exponential fluorescence curve crossing the threshold within 40 cycles (Ct ≤ 38 is typical for strong positives; 38 < Ct ≤ 40 may be considered weak positive and should be confirmed by retesting or alternative method) [3]. The beta-actin internal control must amplify within a defined Ct range (e.g., Ct < 32) to indicate adequate RNA quality and absence of inhibitors. If beta-actin fails, the sample is considered invalid and should be recollected or re-extracted [3]. Co-infections with multiple subtypes can be identified when two or more target signals are present in the same sample.

Workflow for Multiplex RT-qPCR Assay

The following Mermaid diagram illustrates the stepwise workflow from sample collection to result interpretation.

flowchart TD
    A[Collect oral and cloacal swabs], > B[Transport in PBS + antibiotics]
    B, > C[RNA extraction using silica-column or magnetic beads]
    C, > D[One-step multiplex RT-qPCR setup]
    D, > E[Real-time amplification and fluorescence detection]
    E, > F{Internal control Ct < 32?}
    F, No, > G[Invalid sample; repeat extraction or collection]
    F, Yes, > H{Any subtype signal?}
    H, No, > I[Report negative for AIV H5/H7/H9]
    H, Yes, > J[Identify subtype(s) based on fluorophore channel]
    J, > K[Report result with Ct values and subtype]

Role in Surveillance and Point-of-Care Applications

The validated multiplex RT-qPCR assay enables high-throughput screening of large numbers of poultry swabs during outbreak investigations and routine surveillance [1]. The assay’s rapid turnaround (under 2 hours from extracted RNA) supports early outbreak detection and rapid subtyping, which is critical for implementing stamping-out policies or vaccination strategies [1, 2]. For field deployment, portable real-time PCR instruments can be used, but the assay itself remains a laboratory-based molecular test [3]. Complementary point-of-care technologies such as loop-mediated isothermal amplification (LAMP) and CRISPR-based diagnostics are being developed for AIV detection but currently do not offer the same multiplex capacity as RT-qPCR.

The assay described here is closely related to other multiplex panels developed for poultry, such as the multiplex real-time RT-PCR for simultaneous detection of AIV H5, H7, and H9 and the panel that includes Newcastle disease virus [1, 2]. Integration of such tests into national surveillance programs follows standards set by the WOAH for avian health [3].

Conclusion

A well-designed multiplex RT-qPCR assay targeting the HA gene of AIV H5, H7, and H9, with an endogenous internal control, is a powerful tool for poultry diagnostics. Careful primer/probe design, reaction optimization, and thorough validation according to international standards ensure reliable detection and subtyping from oral and cloacal swabs. This assay supports early outbreak detection, rapid subtyping, and informed decision-making in poultry surveillance and control programs.

References

[1] Swayne DE, Suarez DL, Sims LD. Influenza. In: Diseases of Poultry. 13th ed. Wiley-Blackwell; 2013.

[2] Merck Veterinary Manual. Avian Influenza. 11th ed. Merck & Co.; 2016.

[3] OIE (World Organisation for Animal Health). Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.3.4 – Avian influenza (infection with avian influenza viruses). OIE; 2021. *** Disclaimer: This article is for educational and informational purposes only. It is not intended to substitute for professional veterinary advice, diagnosis, treatment, or regulatory guidance. Always consult a licensed veterinarian or qualified specialist regarding animal health, disease diagnosis, and therapeutic decisions.