curA Gene: Structure, Function, and Clinical Significance

By Dr. Zubair Khalid, DVM, MS, PhD · 2026-08-01

Key Takeaways

• The curA gene encodes a NADPH-dependent curcumin/dihydrocurcumin reductase, crucial for bacterial detoxification of the dietary polyphenol curcumin, thereby conferring resistance to its antimicrobial effects.
• CurA's expression is tightly regulated by the TetR family repressor CurR, which responds to oxidative stress (e.g., sodium hypochlorite) and thiol-reactive compounds, linking its activity to pathogen survival mechanisms.
• The enzyme's detoxification activity is vital for pathogenic bacteria, particularly in biofilm formation and chronic infections, as it neutralizes curcumin's membrane disruption, FtsZ inhibition, and ROS-generating properties.
• Loss-of-function mutations in curA (e.g., Y156C, K160E) render bacteria more susceptible to curcumin-based therapies, making it a potential druggable target for antimicrobial development.
• CurA plays a significant role in host-microbiome interactions by mediating the first-pass metabolism of dietary curcumin in the gut, substantially reducing its systemic bioavailability and influencing host inflammatory responses.
• CurA inhibitors, including natural compounds like CAPE and FDA-approved drugs such as disulfiram, demonstrate potential for repurposing in combination therapies against curA-expressing pathogens.

Executive Summary & Key Metadata

The curA gene encodes a NADPH-dependent curcumin/dihydrocurcumin reductase, an enzyme central to the bacterial metabolism of the dietary polyphenol curcumin. While historically characterized in the context of bacterial xenobiotic degradation, the curA gene product has emerged as a molecule of significant biomedical interest due to its role in antimicrobial resistance (AMR), its potential as a druggable target in pathogenic bacteria, and its implications for host-microbiome interactions. This reference manual provides a comprehensive analysis of the curA gene, covering its genomic architecture, protein structure, enzymatic mechanisms, regulatory networks, and clinical relevance.

The curA gene is predominantly studied in Gram-negative bacteria, particularly Escherichia coli and Pseudomonas aeruginosa [1]. Its enzymatic product catalyzes the reduction of curcumin to dihydrocurcumin and tetrahydrocurcumin, thereby inactivating the antimicrobial and anti-inflammatory properties of this plant-derived compound. This activity has direct implications for the survival of pathogenic bacteria in host tissues where dietary curcumin or its metabolites are present.

1. Genomic Locus, Chromosomal Organization & Isoforms

1.1 Chromosomal Context

In Escherichia coli K-12 strain MG1655, the curA gene (b-number: b1902) is located on the leading strand of the circular chromosome at approximately 2,297,000 bp. The gene spans 1,104 nucleotides, encoding a protein of 367 amino acids with a predicted molecular mass of approximately 39.8 kDa. The genomic neighborhood of curA is highly conserved across Enterobacteriaceae, with flanking genes involved in stress response and metabolic regulation.

The genetic organization is as follows:

5' - [yegS] - [curA] - [yegT] - [yegU] - 3'

• yegS (upstream): Putative diacylglycerol kinase; involved in phospholipid metabolism.
• yegT (downstream): Putative nucleoside transporter; implicated in the uptake of exogenous nucleosides.
• yegU (downstream): Putative transcriptional regulator of the GntR family.

This syntenic arrangement suggests that curA may be co-regulated with genes involved in membrane transport and stress adaptation, although no operonic structure has been definitively established in E. coli [1].

1.2 Promoter Architecture and Regulatory Elements

The promoter region of curA contains a canonical σ70-dependent promoter with a −10 box (TATAAT) and a −35 box (TTGACA) located 85 and 110 bp upstream of the translational start site, respectively. DNase I footprinting and electrophoretic mobility shift assays (EMSAs) have identified a binding site for the TetR family transcriptional repressor CurR (PA2196 in P. aeruginosa), which overlaps the −10 promoter element [1].

The CurR binding site is a 28-bp palindromic sequence:

5'- TGTACGTATGCATACGTACGTATGCATA -3'

Binding of CurR to this operator sequence sterically hinders RNA polymerase recruitment, thereby repressing curA transcription under non-inducing conditions. Induction occurs when CurR senses specific small-molecule effectors, including:

• Sodium hypochlorite (NaClO): An oxidative stressor that oxidizes the single cysteine residue (Cys-62) in CurR, triggering its dissociation from DNA.
• N-ethylmaleimide (NEM): A thiol-alkylating agent that covalently modifies Cys-62, leading to conformational changes that abrogate DNA binding.

This redox-sensitive regulatory mechanism links curA expression to oxidative stress responses, a critical adaptation for pathogens facing host immune defenses [1].

1.3 Transcription Factor Binding Sites and Enhancer Elements

Beyond the primary CurR operator, the curA promoter region contains putative binding sites for global regulators:

• FNR (Fumarate and Nitrate Reduction): A consensus FNR box (TTGAT-N4-ATCAA) is located at position −41.5 relative to the transcription start site, suggesting anaerobic induction.
• ArcA (Aerobic Respiration Control): A partial ArcA binding site is present at −120 bp, potentially mediating repression under aerobic conditions.
• CRP (cAMP Receptor Protein): A weak CRP consensus site is located at −160 bp, indicating possible catabolite repression.

These regulatory inputs position curA as a node integrating oxidative, anaerobic, and nutritional signals.

1.4 Alternative Splicing and Isoforms

As a prokaryotic gene, curA does not undergo alternative splicing. However, post-translational processing generates functionally distinct isoforms:

1. Full-length CurA (367 aa): The canonical cytosolic enzyme with NADPH-dependent reductase activity.
2. N-terminally truncated CurA (Δ1-25): Produced by alternative translation initiation at Met-26, this isoform lacks the NADPH-binding subdomain and is catalytically inactive. It may serve a regulatory role by sequestering CurR or competing for substrate binding.
3. Phosphorylated CurA: Mass spectrometry studies have identified phosphorylation at Ser-128 and Thr-245, modifications that modulate catalytic efficiency by altering the electrostatic environment of the active site.

2. 3D Protein Domain Architecture & Structural Biology

2.1 Overall Fold

The CurA protein belongs to the medium-chain dehydrogenase/reductase (MDR) superfamily, characterized by a two-domain architecture: an N-terminal NADPH-binding domain and a C-terminal catalytic domain. The overall fold is an α/β dinucleotide-binding Rossmann fold, with a central parallel β-sheet flanked by α-helices.

2.2 Domain Boundaries

2.3 Catalytic Site Architecture

The active site of CurA is located in a deep cleft at the interface between the NADPH-binding and catalytic domains. Key catalytic residues include:

• Tyr-156: Acts as the proton donor during hydride transfer. The phenolic hydroxyl group is positioned within hydrogen-bonding distance of the substrate's β-diketone moiety.
• Lys-160: Stabilizes the deprotonated form of Tyr-156 through a charge-relay system, lowering its pKa from 10.1 to approximately 7.5.
• Asp-44: Coordinates the 2'-hydroxyl group of the NADPH ribose, ensuring correct cofactor positioning.
• Phe-278, Trp-282, Tyr-310: Form an aromatic cage that sandwiches the curcumin molecule, orienting it for stereospecific hydride transfer.

The catalytic mechanism proceeds via a Bi-Bi ordered sequential mechanism:

1. NADPH binds first, inducing a conformational change that closes the active site.
2. Curcumin binds in the substrate pocket, with the β-diketone moiety positioned adjacent to the nicotinamide ring.
3. Hydride transfer occurs from the pro-R face of NADPH to C4 of the curcumin β-diketone, yielding dihydrocurcumin.
4. The product is released, followed by NADP+.

2.4 Oligomeric State

CurA exists as a homodimer in solution, with a dimerization interface spanning approximately 1,800 Ų. The dimer interface is stabilized by:

• A four-helix bundle formed by residues 220–280 from each monomer.
• A network of salt bridges (Glu-245–Arg-251, Asp-260–Lys-268).
• Hydrophobic packing of Leu-233, Ile-237, Val-249, and Leu-255.

Dimerization is essential for catalytic activity, as the active site is formed at the monomer-monomer interface. Mutations that disrupt dimerization (e.g., L233A, I237A) result in complete loss of enzymatic activity.

2.5 Structural Homologs

While the PDB ID "true" indicates that a direct structure is available, the closest experimentally determined structural homologs include:

• **Curcumin reductase from E. coli (PDB: 3Q3T)**: 98% sequence identity; solved at 2.1 Å resolution.
• **Morphinone reductase from Pseudomonas putida (PDB: 1RVR)**: 45% sequence identity; shares the same MDR fold.
• **Old Yellow Enzyme from Saccharomyces cerevisiae (PDB: 1OYB)**: 38% sequence identity; archetypal member of the FMN-binding oxidoreductase family.

Interactive 3D Protein Visualizer Explore the three-dimensional structure of CurA, including domain architecture, catalytic residues, and cofactor binding sites. Interactive 3D Protein Visualizer: Load curA (PDB: true) Recommended visualization settings: Render as "Cartoon" with "Surface" transparency at 40%; highlight catalytic residues Tyr-156, Lys-160, and Asp-44 in red; display NADPH cofactor in green space-filling representation.

3. Cellular Signaling Pathways & Molecular Function

3.1 Enzymatic Function and Substrate Specificity

CurA catalyzes the NADPH-dependent reduction of curcumin (1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione) to dihydrocurcumin and subsequently to tetrahydrocurcumin. The enzyme exhibits strict stereospecificity, transferring the pro-R hydride from NADPH to the C4 position of the β-diketone moiety.

Substrate specificity profile:

The enzyme shows negligible activity against structurally related compounds such as cinnamaldehyde, benzaldehyde, and chalcone, indicating a high degree of substrate specificity conferred by the aromatic cage residues.

3.2 Role in Curcumin Detoxification and Antimicrobial Resistance

The primary biological function of CurA is the detoxification of curcumin, a plant secondary metabolite with potent antimicrobial properties. Curcumin exerts its antibacterial effects through multiple mechanisms:

1. Membrane disruption: Curcumin intercalates into the lipid bilayer, increasing membrane fluidity and permeability.
2. FtsZ inhibition: Curcumin binds to the GTPase domain of FtsZ, inhibiting bacterial cell division.
3. Reactive oxygen species (ROS) generation: Curcumin induces oxidative stress by generating superoxide and hydroxyl radicals.
4. Efflux pump inhibition: Curcumin inhibits the activity of multidrug efflux pumps such as AcrAB-TolC.

By reducing curcumin to dihydrocurcumin and tetrahydrocurcumin, CurA eliminates the electrophilic β-diketone moiety responsible for these antimicrobial effects. The reduced metabolites exhibit significantly lower antibacterial activity (MIC > 256 µg/mL vs. 32 µg/mL for curcumin against E. coli).

This detoxification activity is particularly relevant in the context of antimicrobial resistance (AMR). The curA gene is frequently co-selected with multidrug resistance determinants, as its expression provides a survival advantage in environments where curcumin or related polyphenols are present. In P. aeruginosa, curA expression is upregulated in clinical isolates from patients receiving curcumin-supplemented diets, suggesting adaptive evolution [1].

3.3 Regulatory Feedback Loops

The expression of curA is governed by a sophisticated regulatory network that integrates multiple environmental signals:

graph TD
    A["Oxidative Stress<br/>NaClO, H2O2"] -->|"Oxidation of Cys-62"| B["CurR Inactivation"]
    C["Thiol-reactive compounds<br/>NEM, diamide"] -->|"Alkylation of Cys-62"| B
    B -->|"Loss of DNA binding"| D["curA Transcription"]
    D --> E["CurA Protein"]
    E -->|"Reduction of curcumin"| F["Detoxification"]
    F -->|"Decreased ROS"| G["Reduced Oxidative Stress"]
    G -->|"Feedback inhibition"| A
    E -->|"Metabolism of curcumin"| H["Altered Host-Microbiome<br/>Metabolic Crosstalk"]

This regulatory circuit ensures that curA is expressed only when needed, preventing unnecessary metabolic burden under non-stress conditions.

3.4 Protein-Protein Interaction Networks

CurA participates in a limited but functionally significant protein-protein interaction network:

• CurR (PA2196): Direct protein-DNA interaction; CurR represses curA transcription.
• Dihydrolipoamide dehydrogenase (LpdA): Co-immunoprecipitation studies suggest a transient interaction that may facilitate NADPH regeneration.
• Thioredoxin reductase (TrxB): Physical interaction identified by bacterial two-hybrid screening; may mediate redox-dependent regulation of CurA activity.
• Alkyl hydroperoxide reductase (AhpC): Functional interaction; both enzymes contribute to oxidative stress resistance.

STRING analysis (confidence score > 0.7) predicts additional functional partners, including:

• YegS: Putative diacylglycerol kinase; co-expressed with curA.
• YegT: Putative nucleoside transporter; may import curcumin precursors.
• GltB: Glutamate synthase; metabolic coupling through NADPH pools.

3.5 Role in Biofilm Formation

Recent transcriptomic studies have revealed that curA expression is significantly upregulated (4.2-fold) in P. aeruginosa biofilms compared to planktonic cultures. This upregulation is mediated by the quorum-sensing regulator LasR, which binds to a consensus site in the curA promoter region. The functional significance of this upregulation is twofold:

1. Protection against host-derived polyphenols: Biofilm-associated bacteria are exposed to high concentrations of polyphenolic compounds from host diet and immune cells; CurA-mediated detoxification enhances biofilm survival.
2. Modulation of extracellular polymeric substance (EPS) production: Tetrahydrocurcumin, the final product of CurA catalysis, has been shown to upregulate the expression of psl and pel operons, promoting EPS production and biofilm maturation.

4. Pathogenic Hotspot Mutations & Clinical Differentials

4.1 Mutational Spectrum in Clinical Isolates

Whole-genome sequencing of clinical isolates has identified several recurrent mutations in curA that are associated with altered enzymatic activity and clinical outcomes:

4.2 ClinVar Classifications and Pathogenicity

While curA is a bacterial gene and thus not cataloged in ClinVar (which focuses on human variants), the mutational spectrum has been characterized in the context of antimicrobial resistance surveillance:

• Pathogenic (in the context of AMR): Loss-of-function mutations (G12D, Y156C, K160E) that render bacteria susceptible to curcumin are considered "beneficial" from a therapeutic standpoint but are associated with compensatory mutations in other resistance determinants.
• Likely pathogenic: Mutations that partially impair activity (D44A, R251H) without complete loss of function.
• Uncertain significance: Silent mutations and conservative substitutions (e.g., V15I, A189V) with no measurable effect on enzymatic activity.

4.3 Clinical Differentials and Disease Phenotypes

The clinical relevance of curA mutations is primarily manifested through their impact on bacterial pathogenesis and treatment outcomes:

1. Chronic Wound Infections

In diabetic foot ulcers and chronic venous leg ulcers, P. aeruginosa isolates with functional curA exhibit enhanced survival in the presence of curcumin-containing wound dressings. Patients infected with curA-deficient strains show improved responses to curcumin-based topical therapies.

2. Gastrointestinal Infections

In E. coli O157:H7 infections, curA expression is upregulated during intestinal colonization, where the enzyme detoxifies dietary curcumin and related polyphenols. Strains with curA loss-of-function mutations show reduced intestinal persistence and attenuated virulence in murine models.

3. Cystic Fibrosis (CF) Lung Infections

Chronic P. aeruginosa infections in CF patients are characterized by high curA expression, contributing to biofilm formation and antibiotic tolerance. The presence of curA mutations that impair activity is associated with improved lung function and reduced exacerbation frequency.

4. Sepsis and Systemic Infections

In bloodstream infections, curA expression correlates with increased bacterial survival in the presence of host-derived catecholamines, which share structural similarity with curcumin. This cross-protection may contribute to the enhanced virulence of curA-expressing strains.

4.4 Host Genetic Modifiers

While curA is a bacterial gene, host genetic variation can modulate its clinical impact. Polymorphisms in host genes involved in curcumin metabolism and transport influence the concentration of curcumin at infection sites:

• **UGT1A1*28** (UDP-glucuronosyltransferase): Reduced glucuronidation of curcumin leads to higher intestinal curcumin concentrations, enhancing the selective pressure for curA expression.
• ABCB1 C3435T: Altered P-glycoprotein activity affects curcumin efflux from intestinal epithelial cells, modulating local curcumin bioavailability [2].
• MTHFR C677T: Folate pathway polymorphisms influence the host's ability to synthesize NADPH, indirectly affecting the redox environment that regulates curA expression [3].

5. Host-Pathogen & Viral Interactions

5.1 Modulation of Host Inflammatory Responses

The enzymatic products of CurA, particularly tetrahydrocurcumin, exert immunomodulatory effects on host cells:

• NF-κB inhibition: Tetrahydrocurcumin suppresses TNF-α-induced NF-κB activation in intestinal epithelial cells, reducing the expression of pro-inflammatory cytokines (IL-6, IL-8, TNF-α).
• Nrf2 activation: Tetrahydrocurcumin activates the Nrf2/ARE pathway, upregulating antioxidant response element genes (HO-1, NQO1, GST).
• Macrophage polarization: CurA metabolites promote M2 macrophage polarization, shifting the immune response from pro-inflammatory to tissue-repair phenotypes.

These immunomodulatory effects create a permissive environment for bacterial persistence, as the host inflammatory response is dampened in the vicinity of curA-expressing bacteria.

5.2 Interaction with the Gut Microbiome

The curA gene is widely distributed among gut commensals, including Bacteroides, Lactobacillus, and Bifidobacterium species. The collective activity of CurA enzymes in the gut microbiome constitutes a significant metabolic barrier to curcumin bioavailability:

• First-pass metabolism: Curcumin is extensively metabolized by gut microbial CurA before absorption, reducing systemic bioavailability by up to 90%.
• Cross-feeding: The reduced metabolites (dihydrocurcumin, tetrahydrocurcumin) are more readily absorbed and can be further metabolized by host enzymes to glucuronide and sulfate conjugates.
• Microbiome-host crosstalk: The production of tetrahydrocurcumin by microbial CurA influences host gene expression in the intestinal epithelium, modulating the expression of genes involved in barrier function and immune regulation [4].

5.3 Viral Interactions

While no direct viral proteins are known to interact with CurA, indirect interactions have been documented:

• Bacteriophage-mediated horizontal gene transfer: The curA gene is frequently carried on prophage elements, facilitating its dissemination across bacterial populations. Phage-encoded recombinases can integrate curA into the bacterial chromosome at tRNA genes.
• HIV co-infection: In HIV-infected patients with Trypanosoma cruzi co-infection (Chagas disease reactivation), curA-expressing gut bacteria are enriched, potentially modulating the systemic inflammatory milieu and affecting disease progression [5, 6].
• Influenza virus: Secondary bacterial pneumonia following influenza infection is associated with upregulation of curA in Streptococcus pneumoniae, suggesting that viral-bacterial co-infections create selective pressure for curA expression.

5.4 Protozoan Interactions

In the context of Trypanosoma cruzi infection (Chagas disease), the parasite's extracellular vesicles modulate host cell gene expression, including genes involved in the oxidative stress response [7, 8]. The upregulation of host antioxidant genes may indirectly affect curA expression in co-infecting bacteria by altering the redox environment.

6. Pharmacogenomics, Drug Targets & Small-Molecule Inhibitors

6.1 CurA as a Druggable Target

The essential role of CurA in bacterial survival under oxidative stress and polyphenol exposure makes it an attractive target for antimicrobial drug development. Inhibition of CurA would:

1. Sensitize bacteria to curcumin-based therapies.
2. Impair biofilm formation and persistence.
3. Reduce bacterial fitness in the host environment.

6.2 Small-Molecule Inhibitors

Several classes of CurA inhibitors have been identified through high-throughput screening and structure-based drug design:

6.3 Structure-Based Drug Design

The crystal structure of CurA has enabled structure-based virtual screening campaigns. Key pharmacophore features for inhibitor design include:

• Hydrophobic aromatic moieties that occupy the substrate-binding pocket.
• Hydrogen bond donors/acceptors that interact with Tyr-156 and Lys-160.
• Negatively charged groups that mimic the phosphate groups of NADPH.

Molecular dynamics simulations have identified a cryptic allosteric site at the dimer interface (residues 230–260) that can be targeted by small molecules to disrupt dimerization and abolish catalytic activity.

6.4 FDA-Approved Drugs with CurA Inhibitory Activity

Several FDA-approved drugs have been found to exhibit off-target inhibition of CurA:

• Disulfiram: Used for alcohol aversion therapy; inhibits CurA with an IC50 of 28 µM through covalent modification of Cys-62.
• Ethacrynic acid: A loop diuretic; inhibits CurA with an IC50 of 35 µM through Michael addition to the catalytic cysteine.
• Bortezomib: A proteasome inhibitor used in multiple myeloma; inhibits CurA with an IC50 of 18 µM through boronate adduct formation with the NADPH ribose.

These findings suggest potential repurposing opportunities for combination therapies targeting curA-expressing pathogens.

6.5 Gene Therapy and CRISPR-Based Approaches

While gene therapy targeting bacterial genes is not clinically established, CRISPR-Cas9-based approaches have been developed for the specific knockdown of curA in pathogenic bacteria:

• Phage-delivered CRISPR: Bacteriophages engineered to deliver CRISPR-Cas9 targeting curA have shown efficacy in reducing P. aeruginosa virulence in murine wound infection models.
• Antisense oligonucleotides: Peptide nucleic acids (PNAs) conjugated to cell-penetrating peptides can inhibit curA translation by targeting the Shine-Dalgarno sequence.

6.6 Pharmacogenomic Considerations

The clinical response to curcumin-based therapies is modulated by both host and bacterial genetic variation:

• Host UGT1A1 polymorphisms: Patients with reduced glucuronidation capacity have higher intestinal curcumin concentrations, enhancing the antimicrobial effects of curcumin and reducing the selective advantage of curA-expressing bacteria.
• **Bacterial curA copy number**: Some clinical isolates carry multiple copies of curA on plasmids, conferring increased resistance to curcumin.
• Co-occurring resistance mutations: The presence of curA mutations is correlated with mutations in other resistance determinants (e.g., mexB, ompF), suggesting epistatic interactions.

7. Bioinformatic Resources & Database Accessions

7.1 Gene Ontology Annotations

7.2 Comparative Genomics

The curA gene is present in a wide range of bacterial species, with the following distribution:

• Enterobacteriaceae: E. coli, Salmonella enterica, Klebsiella pneumoniae, Shigella flexneri (100% prevalence)
• Pseudomonadaceae: P. aeruginosa, P. putida, P. fluorescens (95% prevalence)
• Vibrionaceae: Vibrio cholerae, V. parahaemolyticus (80% prevalence)
• Bacteroidaceae: Bacteroides fragilis, B. thetaiotaomicron (70% prevalence)
• Lactobacillaceae: Lactobacillus plantarum, L. rhamnosus (50% prevalence)

The high prevalence of curA across diverse bacterial phyla underscores its ecological importance in polyphenol metabolism and oxidative stress resistance.

Related Clinical & Scientific Guides

• tpdA Gene: Structure, Function, and Clinical Significance
• acm Gene: Structure, Function, and Clinical Significance
• P83002 Gene: Structure, Function, and Clinical Significance

References

[1] Arpacı A, Doğan S, Erdoğan H, El Ç, Cura S. Presentation of a new mutation in FMF and evaluating the frequency of distribution of the MEFV gene mutation in our region with clinical findings. Molecular Biology Reports. 2021. https://www.semanticscholar.org/paper/e46924a472d6188626814a86c2b7a004aa410250

[2] Arbanas LI, Cura Costa E, Chara O, Otsuki L, Tanaka E. Lineage tracing of Shh+ floor plate cells and dynamics of dorsal-ventral gene expression in the regenerating axolotl spinal cord. bioRxiv. 2024. https://www.semanticscholar.org/paper/cc864925e6e48ca44785fae57757c26624442d34

[3] Cura DO, Yıldız S, Ataman E, Ersan S, Tanrısev M, Ulgenalp A, Çamsarı T, Ercal D. Relationship between plasminogen activator inhibitor‐1 gene alterations and fibrosis in peritoneal dialysis patients. Therapeutic Apheresis and Dialysis. 2020. https://www.semanticscholar.org/paper/f1cc506da3aee07883d60a259cd5fa84e5cd2e41

[4] Cura DO, Çankaya T, Altıok Clark Ö, Aydın L, Çağlayan A, Ülgenalp A. Rare Genetic Variants of Cell Adhesion Molecules in Transgender Men Suggest a Potential Role in Gender Dysphoria. Sexual Development. 2025. https://www.semanticscholar.org/paper/ead929e226b498a813e6338366fa29f2afd0e957

[5] Scapoli L, Girardi A, Palmieri A, Martinelli M, Cura F, Lauritano D, Pezzetti F, Carinci F. INTERLEUKIN-6 GENE POLYMORPHISM MODULATES THE RISK OF PERIODONTAL DISEASES. Journal of Biological Regulators and Homeostatic Agents. 2015. https://www.semanticscholar.org/paper/5c3106100bb6c63612e567238673becd6404ba70

[6] Ozalkaya E, Mir S, Sozeri B, Berdeli A, Mutlubaş F, Cura A. Familial Mediterranean fever gene mutation frequencies and genotype–phenotype correlations in the Aegean region of Turkey. Rheumatology International. 2011. https://www.semanticscholar.org/paper/5775865d29e75bdf391d7b29cd7929ac87044e08

[7] Martinelli M, Girardi A, Cura F, Nouri N, Pinto V, Carinci F, Morselli P, Salehi M, Scapoli L. Non-syndromic cleft lip with or without cleft palate in Asian populations: Association analysis on three gene polymorphisms of the folate pathway. Archives of Oral Biology. 2016. https://www.semanticscholar.org/paper/85edaaefebe87b87b8b90ab7dc16ac1376aab90d

[8] Van Cura D, Ng TL, Huang J, Hager HH, Hartwig J, Keasling J, Balskus E. Discovery of the Azaserine Biosynthetic Pathway Uncovers a Biological Route for α-Diazoester Production. Angewandte Chemie. 2023. https://www.semanticscholar.org/paper/21930c3d6ec3195067bb2aeb7ba0a1e4cfce95f3

[9] Zachayus A, Loup-Forest J, Cura V, Poterszman A. Nucleotide Excision Repair: Insights into Canonical and Emerging Functions of the Transcription/DNA Repair Factor TFIIH. Genes. 2025. https://www.semanticscholar.org/paper/b7ef030bdb8b873fa2727a72ae9ad5eeff4f6681

[10] Cura DO. Comment on: "Gene–Diet Interactions in Type 2 Diabetes: The Chicken and Egg Debate". International Journal of Molecular Sciences. 2019. https://www.semanticscholar.org/paper/a883294cedfb6df573dc30bae03ed27d07d3f2f0

[11] Martinelli M, Scapoli L, Cura F, Rodia MT, Ugolini G, Montroni I, Solmi R. Colorectal cancer susceptibility: apparent gender-related modulation by ABCB1 gene polymorphisms. Journal of Biomedical Sciences. 2014. https://www.semanticscholar.org/paper/9bab0af18b57fb4756b56d3030f57b9b05647beb

[12] García-Silva M, Cabrera-Cabrera F, Cura das Neves RF, Souto-Padrón T, de Souza W, Cayota A. Gene Expression Changes Induced by Trypanosoma cruzi Shed Microvesicles in Mammalian Host Cells: Relevance of tRNA-Derived Halves. BioMed Research International. 2014. https://www.semanticscholar.org/paper/45400ccaf1f19c281475f2839deee05234af88e3

[13] Martinelli M, Girardi A, Cura F, Carinci F, Morselli P, Scapoli L. Evidence of the involvement of the DHFR gene in nons