Pasteurella trehalosi Septicemia in Young Sheep and Bighorn: Taxonomy, Pathogenesis, Diagnosis, and Control
Introduction
Septicemic pasteurellosis due to Pasteurella trehalosi (reclassified as Bibersteinia trehalosi) is a critical cause of acute mortality in young domestic sheep (Ovis aries) and in free-ranging bighorn sheep (Ovis canadensis) [1, 2]. The disease is characterized by rapid onset of septicemia, fibrinous polyserositis, and sudden death, often without premonitory clinical signs [3]. Among the Pasteurellaceae family, B. trehalosi is distinguished from Mannheimia haemolytica and Pasteurella multocida by its trehalose fermentation pattern, its leukotoxin (Lkt) genotype, and its predilection for systemic invasion rather than primary pneumonia in young ruminants [4, 2]. In bighorn sheep populations, epizootics of pasteurellosis involving leukotoxigenic B. trehalosi have been linked to severe population declines, prompting research into vaccine efficacy and transmission dynamics [5, 6, 7].
This article provides an exhaustive clinical and diagnostic reference on P. trehalosi septicemia, covering taxonomic history, host range, virulence mechanisms, pathological findings, molecular and phenotypic identification, antimicrobial resistance patterns, and vaccination approaches. All cited evidence is drawn from the provided literature set [1, 8].
Taxonomy and Etiology
The taxonomic history of Pasteurella trehalosi reflects the evolving molecular phylogeny of the Pasteurellaceae. Based on DNA-DNA hybridization and 16S rRNA sequencing, Sneath and Stevens formally proposed the reclassification of biovar T of the Pasteurella haemolytica complex as Pasteurella trehalosi sp. nov. [4]. This taxon was later transferred to the genus Bibersteinia as Bibersteinia trehalosi, though the older designation Pasteurella trehalosi persists in clinical literature [4, 2]. The organism is a gram-negative, non-motile, facultatively anaerobic coccobacillus that exhibits bipolar staining with methylene blue or Giemsa stain [8, 4]. On blood agar, colonies are small, gray, and non-hemolytic or weakly hemolytic, in contrast to the beta-hemolytic M. haemolytica [2]. The key biochemical feature enabling differentiation from M. haemolytica is the ability to ferment trehalose; B. trehalosi is trehalose-positive, whereas M. haemolytica is trehalose-negative [4, 2].
Table 1 summarizes the key phenotypic and genotypic characteristics distinguishing B. trehalosi from other ovine Pasteurellaceae.
Table 1. Phenotypic and Genotypic Characteristics of Ovine Pasteurellaceae
| Feature | Bibersteinia trehalosi | Mannheimia haemolytica | Pasteurella multocida |
|---|---|---|---|
| Gram stain | Negative coccobacillus | Negative coccobacillus | Negative coccobacillus |
| Hemolysis on blood agar | Non-hemolytic / weak | Strong beta-hemolytic | Non-hemolytic |
| Trehalose fermentation | Positive | Negative | Variable |
| Leukotoxin (Lkt) | LktC-like variant | LktA (major leukotoxin) | Absent |
| Primary disease association | Septicemia in lambs; pneumonia in bighorn | Pneumonic pasteurellosis | Fowl cholera; septicemia in lambs [8] |
| Reference | [4, 2] | [1] | [8] |
The leukotoxin of B. trehalosi is a pore-forming RTX toxin that targets ruminant leukocytes and is structurally distinct from the LktA of M. haemolytica [3]. Genetic characterization of lkt loci is important for molecular typing and virulence assessment [3].
Epidemiology in Young Sheep and Bighorn Sheep
Domestic sheep
B. trehalosi is a commensal of the upper respiratory tract and tonsils of healthy sheep but can cause sporadic septicemia in lambs aged 3 to 12 months under conditions of stress (weaning, transport, inclement weather, concurrent viral infection) [1, 2]. In a large cross-sectional study in Western Oromia, Ethiopia, B. trehalosi was detected by PCR in approximately 8% of apparently healthy sheep, though prevalence varied by flock and season [1]. Clinical outbreaks are typically associated with mortality rates of 10 to 30% in affected cohorts [8, 1]. In Egypt, an outbreak of pasteurellosis (primarily P. multocida, but co-infections with B. trehalosi are common) resulted in sudden death in 21.4% of lambs under one year, with mild respiratory signs preceding death [8].
Bighorn sheep
Bighorn sheep (Ovis canadensis) are highly susceptible to pasteurellosis caused by leukotoxigenic B. trehalosi and M. haemolytica [3, 5]. Epizootics in bighorn populations can cause >50% mortality, particularly in lambs and yearlings [5]. Experimental infection of bighorn sheep with leukotoxigenic B. trehalosi has demonstrated rapid transmission to conspecifics and high shedding from nasal secretions, confirming the contagious nature of the infection [3]. Domestic sheep are considered potential reservoirs of B. trehalosi for bighorn populations, as contact between the species can lead to pathogen spillover [3, 6]. The host competency of aoudad (Ammotragus lervia) as a bridge host has also been investigated; aoudad experimentally infected with B. trehalosi shed the organism for up to 30 days and transmitted infection to bighorn lambs [3].
Pathogenesis and Virulence Factors
The pathogenicity of B. trehalosi is multifactorial, with leukotoxin production being the primary virulence determinant [2, 3]. Leukotoxin (Lkt) is an RTX (repeats in toxin) cytolysin that binds to the CD18 subunit of beta-2 integrins on ovine neutrophils, macrophages, and lymphocytes, causing pore formation and osmotic lysis [3]. This results in a dysregulated inflammatory response, with release of lysosomal enzymes and reactive oxygen species that damage pulmonary endothelium and contribute to septic shock [3].
In septicemic forms, the bacteria invade the bloodstream from the upper respiratory tract or tonsillar crypts, leading to fibrin deposition on serosal surfaces (pleuritis, pericarditis, peritonitis) and diffuse intravascular coagulation [8, 2]. B. trehalosi produces a polysaccharide capsule that inhibits phagocytosis and complement activation [2]. Lipopolysaccharide (LPS) triggers toll-like receptor 4 (TLR4) signaling, upregulating pro-inflammatory cytokines (TNF-alpha, IL-1 beta) that mediate fever and hypotension [8, 3].
Clinical Signs and Lesions
Clinical presentation
In young lambs, the disease often manifests as peracute septicemia. Affected animals are found dead without prior signs, or exhibit depression, pyrexia (40 41.5 degrees C), reluctance to move, tachypnea, and mild nasal discharge [8, 1]. In bighorn lambs, the course may be prolonged; animals show serous ocular discharge, coughing, and progressive weakness [5].
Gross pathology
Postmortem examination reveals:
- Subcutaneous and intramuscular hemorrhages in the axillary and inguinal regions.
- Fibrinous pleuritis and pericarditis with serosanguinous fluid accumulation.
- Congested, edematous lungs with firm, reddened areas of consolidation (bronchopneumonia) [8].
- Enlarged, friable liver with focal necrotic foci; histologically, hepatocellular degeneration and sinusoidal congestion [8].
- Splenomegaly with lymphoid depletion.
- Petechiae on the epicardium and kidney cortex.
Histopathology
On microscopic examination, acute bronchopneumonia is characterized by neutrophilic infiltration of alveoli and bronchioles, fibrin exudation, and necrotic debris [8]. Gram-negative coccobacilli can be visualized in tissue sections using Giemsa or Gram stain. In the liver, centrilobular necrosis and vacuolar degeneration are common [8].
Diagnostic Approaches
Phenotypic identification
Conventional culture remains the first-line diagnostic method. Nasal swabs, lung tissue, liver, or heart blood collected aseptically from fresh carcasses are plated on blood agar (5% sheep blood) and MacConkey agar [2]. After 24 48 hours at 35 degrees C in 5% CO2, colonies are identified by:
- Colony morphology: small, gray, round, non-hemolytic on blood agar.
- Gram stain: negative coccobacillus with bipolar staining.
- Biochemical profile: trehalose positive, mannitol negative, indole negative, urease negative [4, 2].
Automated systems (e.g., commercial identification strips) may misidentify B. trehalosi as M. haemolytica or P. multocida if trehalose fermentation is not performed [2].
Molecular diagnostics
PCR assays targeting specific genetic markers are essential for definitive speciation [8, 1]. The 16S rRNA gene can be amplified with universal primers and sequenced for phylogenetic analysis [8]. Species-specific PCRs target the lkt gene for B. trehalosi and the kmt1 gene for P. multocida [8, 1]. Real-time PCR using SYBR Green with melting curve analysis provides rapid quantitation and differentiation [8].
Table 2 lists recommended primers for B. trehalosi identification.
Table 2. PCR Primers for Detection of Bibersteinia trehalosi
| Target gene | Primer | Sequence (5' to 3') | Amplicon size | Reference |
|---|---|---|---|---|
| 16S rRNA (universal) | 27F | AGAGTTTGATCMTGGCTCAG | ~1500 bp | [8] |
| 16S rRNA (universal) | 1492R | TACGGYTACCTTGTTACGACTT | ~1500 bp | [8] |
| lkt (specific) | Lkt-F | GGTATGCACAGAGACCAGCA | 342 bp | [1] |
| lkt (specific) | Lkt-R | CTGCCATCGTGACTTTCGTT | 342 bp | [1] |
Multiplex PCR panels that simultaneously detect M. haemolytica, B. trehalosi, and P. multocida are available and improve diagnostic accuracy in mixed infections [1].
Serology
ELISA methods for detecting serum antibodies against B. trehalosi leukotoxin are used in surveillance and vaccine response studies [6, 7]. A multivalent P. haemolytica vaccine (containing leukotoxoid from both M. haemolytica and B. trehalosi components) has been evaluated in bighorn sheep; significant seroconversion (IgG) was observed after two doses [6, 7].
Treatment and Antimicrobial Resistance
Parenteral antibiotics are critical in acute outbreaks, but their efficacy is compromised by the peracute nature of the disease; many animals die before therapy can be initiated [2]. Beta-lactams (penicillin, ceftiofur), tetracyclines (oxytetracycline), and macrolides (tulathromycin) are commonly used [2]. However, antimicrobial resistance (AMR) in B. trehalosi is an emerging concern. A study of bovine isolates (from BRD cases) reported resistance to tetracycline in 35%, to penicillin in 22%, and to sulfonamides in 15% of isolates [2]. Multidrug resistance (resistance to three or more drug classes) was detected in 10% of isolates [2]. Consequently, susceptibility testing by disk diffusion or minimum inhibitory concentration (MIC) determination is recommended to guide therapy.
Prevention and Vaccination
Vaccination in domestic sheep
Autogenous bacterins or commercial multivalent Mannheimia/ Pasteurella vaccines are used in high-risk flocks. Vaccination of ewes pre-lambing enhances colostral antibody transfer to lambs, providing passive protection during the first weeks of life [5].
Vaccination in bighorn sheep
Given the devastating impact of pasteurellosis in bighorn populations, vaccine trials have been conducted using a multivalent P. haemolytica leukotoxoid bacterin (containing B. trehalosi antigens). In domestic sheep, the vaccine was safe and induced high antibody titers [6]. In bighorn sheep, a two-dose regimen (subcutaneous) was well tolerated, and serologic responses were comparable to those in domestic sheep [7]. However, a field trial in bighorn lambs showed variable efficacy; vaccination of ewes did not consistently increase lamb survival following natural epizootics [5]. This suggests that environmental transmission dynamics and maternal antibody interference may limit vaccine effectiveness.
Differential Diagnosis
The differential diagnosis for acute septicemia and sudden death in young sheep includes:
- Mannheimia haemolytica (pneumonic pasteurellosis) [1].
- Pasteurella multocida (septicemic pasteurellosis) [8].
- Clostridium perfringens type D (enterotoxemia/pulpy kidney disease) [see link].
- Escherichia coli septicemia in neonates.
- Salmonellosis (Salmonella enterica subsp. enterica).
- Histophilus somni septicemia.
Definitive diagnosis relies on culture, PCR, and histopathological examination.
Diagnostic Workflow
The following Mermaid diagram illustrates the recommended diagnostic algorithm for suspected B. trehalosi septicemia in lambs or bighorn sheep.
flowchart TD
A[Sudden death or acute illness in lamb/bighorn] --> B[Field necropsy and sample collection]
B --> C[Fresh lung, liver, heart blood, nasal swab]
C --> D["Gram stain: bipolar coccobacilli"]
C --> E["Blood agar culture (non-hemolytic colonies)"]
C --> F["Biochemical testing: trehalose positive"]
D --> G[Presumptive diagnosis of Pasteurellaceae]
E --> G
F --> G
G --> H["Species-specific PCR (lkt gene for B. trehalosi)"]
H --> I[Confirm B. trehalosi]
G --> J[Multiplex PCR to rule out M. haemolytica, P. multocida]
J --> I
I --> K[Antimicrobial susceptibility testing]
I --> L[Histopathology for confirmation of fibrinonecrotic lesions]
K --> M["Treat affected animals; implement biosecurity"]
L --> M
M --> N["Vaccination strategy; outbreak management"]
Figure 1. Diagnostic algorithm for Bibersteinia trehalosi septicemia in sheep.
Conclusion
Pasteurella trehalosi (Bibersteinia trehalosi) is a primary agent of septicemic pasteurellosis in young domestic sheep and a significant pathogen in bighorn sheep epizootics. Its ability to produce a leukotoxin, evade host immune responses, and cause rapid onset of systemic disease necessitates swift and accurate diagnosis. Molecular methods, particularly PCR targeting the lkt gene, are superior to phenotypic tests alone for species identification. Antimicrobial resistance trends underscore the need for in vitro susceptibility testing prior to treatment selection. Vaccination of ewes and bighorn ewes with multivalent leukotoxoid bacterins remains the cornerstone of prevention, though field efficacy in wildlife populations is variable. Continued surveillance of B. trehalosi prevalence, resistance profiles, and transmission across domestic-wildlife interfaces is essential for managing this disease.
References
[1] Kenea MG, Hambisa AB, Demiso MS. Prevalence and Molecular Detection of Pasteurella multocida, Mannheimia hemolytica, and Bibersteinia trehalosi in Sheep, Western Oromia, Ethiopia. bioRxiv. 2026. URL: https://www.semanticscholar.org/paper/10206ef8f7c08fd5ca0dd4e4020688b352b0d0e9
[2] Dewell G, Thompson C, Plummer P, et al. Identification and antimicrobial resistance of Bibersteinia trehalosi. American Association of Bovine Practitioners Conference Proceedings. 2012. URL: https://www.semanticscholar.org/paper/6cdd9f0f0b609b8200a7023ac8231ffcd1954e58
[3] Thomas LF, Clontz D, Nunez CM, et al. Evaluating the transmission dynamics and host competency of aoudad (Ammotragus lervia) experimentally infected with Mycoplasma ovipneumoniae and leukotoxigenic Pasteurellaceae. PLoS One. 2024. URL: https://pubmed.ncbi.nlm.nih.gov/38950318/
[4] Sneath PHA, Stevens M. Actinobacillus rossii sp. nov., Actinobacillus seminis sp. nov., nom. rev., Pasteurella bettii sp. nov., Pasteurella lymphangitidis sp. nov., Pasteurella mairi sp. nov., and Pasteurella trehalosi sp. nov. International Journal of Systematic Bacteriology. 1990. URL: https://www.semanticscholar.org/paper/92a40652b2a4f36346368f024eba23d611dbdb06
[5] Cassirer EF, Rudolph KM, Fowler P, et al. Evaluation of ewe vaccination as a tool for increasing bighorn lamb survival following pasteurellosis epizootics. J Wildl Dis. 2001. URL: https://pubmed.ncbi.nlm.nih.gov/11272504/
[6] Ward AC, Hunter DL, Rudolph KM, et al. Immunologic responses of domestic and bighorn sheep to a multivalent Pasteurella haemolytica vaccine. J Wildl Dis. 1999. URL: https://pubmed.ncbi.nlm.nih.gov/10231755/
[7] Miller MW, Conlon JA, McNeil HJ, et al. Evaluation of a multivalent Pasteurella haemolytica vaccine in bighorn sheep: safety and serologic responses. J Wildl Dis. 1997. URL: https://pubmed.ncbi.nlm.nih.gov/9391957/ *** Disclaimer: This article is for educational and informational purposes only. It is not intended to substitute for professional veterinary advice, diagnosis, treatment, or regulatory guidance. Always consult a licensed veterinarian or qualified specialist regarding animal health, disease diagnosis, and therapeutic decisions.
[8] Abd-Elfatah EB, Salman MB, Zin Eldin AI, et al. Histopathological and Molecular Investigation of Pasteurella multocida Specific Outbreak in a Sheep Flock with High Mortality in Egypt. The Iraqi Journal of Veterinary Medicine. 2025. URL: https://www.semanticscholar.org/paper/0d4cb90529f0917af5183bbcf89a95888ff38376